v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Pteropus vampyrus (large flying fox) microRNA 369 (ENSPVAG00000027490.1) secondary structure diagram

Pteropus vampyrus (large flying fox) microRNA 369 (ENSPVAG00000027490.1) URS000075D5A7_132908

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UUGAAGGGAGAUCGACCGUGUUAUAUUCGCUUUAUUGACUUCGAAUAAUACAUGGUUGAUCUUUUCUCAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 18 other species

  1. Carlito syrichta (Philippine tarsier) miRNA (ENSTSYG00000022716.2)
  2. Cercocebus atys miRNA (ENSCATG00000022698.1)
  3. Colobus angolensis palliatus miRNA (ENSCANG00000015377.1)
  4. Gorilla gorilla gorilla microRNA 369 (ENSGGOG00000029553.2)
  5. Homo sapiens microRNA hsa-mir-369 precursor
  6. Macaca fascicularis microRNA 369 (ENSMFAG00000015637.2)
  7. Macaca mulatta microRNA mml-mir-369 precursor
  8. Macaca nemestrina (Pig-tailed macaque) miRNA (ENSMNEG00000004909.1)
  9. Mandrillus leucophaeus (Drill) miRNA (ENSMLEG00000017564.1)
  10. Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 369 (ENSNLEG00000020783.2)
  11. Otolemur garnettii (small-eared galago) miRNA (ENSOGAG00000017516.1)
  12. Pan paniscus (bonobo) microRNA 369 (ENSPPAG00000014180.1)
  13. Pan troglodytes ptr-mir-369 (ENSPTRG00000027593.2)
  14. Piliocolobus tephrosceles (Ugandan red Colobus) miRNA (ENSPTEG00000002399.1)
  15. Pongo abelii miRNA
  16. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-369 precursor
  17. Rhinopithecus bieti miRNA (ENSRBIG00000012072.1)
  18. Rhinopithecus roxellana miRNA (ENSRROG00000006413.1)
 2D structure