v20

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Danio rerio (zebrafish) microRNA dre-mir-153b precursor URS000075D595_7955

Automated summary: This pre miRNA sequence is 148 nucleotides long and is found in Danio rerio. Annotated by 4 databases (Ensembl, miRBase, RefSeq, ENA). Described in 9 papers. Matches 1 Rfam family (mir-153, RF00650). Danio rerio (zebrafish) microRNA dre-mir-153b precursor sequence is a product of ENSDARG00000083395.2, mir-153b precursor, mir-153b, dre-mir-153b precursor, mir153b, mir-153b precurso genes. Found in the zebrafish reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
    		•  {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset 

    GAGCGAUGGAGCGCGGUAGCGAGGUAUUGCACAGCUGUCUGUGUCAUUUUUGUGGUUUGCAGCUAGUAGUCUGGUUCCAGUUGCAUAGUCACAAAAAUGAGCACAGACAGAUGUGACUGCAGCAACGCUGAUGAAACGCUCCAUCGCC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.