Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) microRNA mmu-mir-9 precursor (mmu-mir-9-2) URS000075D55C_10090

Automated summary: This pre miRNA sequence is 72 nucleotides long and is found in Mus musculus. Annotated by 6 databases (Ensembl/GENCODE, RefSeq, Ensembl, ENA, MGI, miRBase). Described in 33 papers. Matches 1 Rfam family (mir-9, RF00237). Mus musculus (house mouse) microRNA mmu-mir-9 precursor (mmu-mir-9-2) sequence is a product of mir-9-2, Mir9-2, mir-9-2 precurso, mir-9-2 precursor, mmu-mir-9-2 precursor genes.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GUUGUUAUCUUUGGUUAUCUAGCUGUAUGAGUGUAUUGGUCUUCAUAAAGCUAGAUAACCGAAAGUAAAAAC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 13 other species

    1. Cavia aperea (Brazilian guinea pig) microRNA 9-2
    2. Cavia porcellus microRNA 9-2
    3. Chinchilla lanigera (Long-tailed chinchilla) miRNA
    4. Cricetulus griseus (Chinese hamster) miRNA (Mir9)
    5. Dipodomys ordii miRNA
    6. Fukomys damarensis (Damara mole rat) miRNA
    7. Heterocephalus glaber miRNA
    8. Ictidomys tridecemlineatus miRNA
    9. Mesocricetus auratus (Golden Hamster) miRNA
    10. Microtus ochrogaster microRNA 9-2
    11. Mus caroli microRNA 9-2
    12. Mus pahari microRNA 9-2
    13. Mus spretus microRNA 9-2
    14. Nannospalax galili miRNA