Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-6750 precursor URS000075D4B7_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR6750: MIR6750 is a human splicing-derived miRNA, also known as a "mirtron" [PMC8569761]. In a study analyzing serum and urine samples, the expression levels of MIR6750 were found to be non-significant between the patient and control group [PMC8569761]. However, MIR6750 was upregulated in both urine and serum samples of patients with prostate cancer compared to healthy controls [PMC8569761]. The expression levels of MIR6750 were higher in serum samples compared to urine specimens in patients with prostate cancer [PMC8569761]. The accuracy of miRNA quantification was confirmed by reexamining MIR6750 using qRT-PCR in a subset of samples [PMC8569761]. In addition to prostate cancer, downregulation of MIR6750 has been observed in nonsmall cell lung cancer by silencing the insulin-like growth factor 1 receptor (IGF-1R) gene [PMC8569761]. The study also identified other miRNAs that were detected in both urine and serum samples from both patients and healthy controls, including MIR320A [PMC8569761]. Furthermore, an miRNA expression signature analysis identified several top-ranked miRNAs including MIR6750 that may be relevant in prostate cancer [PMC9284388]. Overall, while the significance of MIR6750 in prostate cancer is still being explored, it shows potential as a biomarker for this disease.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCUGUCAGGGAACAGCUGGGUGAGCUGCUGCCCCAGAGGCCCAGCAGGUGUCCAGAACUCACCCUCUGCUCCCAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

Publications