Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-618 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-618 precursor URS000075D4B4_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR618: MIR618 is a small molecule composed of 98 nucleotides and is the single transcription product of MIR618, which is located on chromosome 12 [PMC6706600]. The function of MIR618 has not been extensively studied [PMC4695081]. The variant rs2682818 in MIR618 leads to increased expression of miR-618 and a different distribution of miR-618 isomiRs [PMC4695081]. The variant rs2682818 A>C in MIR618 is more frequently present in patients with idiopathic generalized epilepsy (IGE) compared to controls [PMC4695081]. MIR618 is located within the first intron of the gene LIN7A [PMC4695081]. Stable SH-SY5Y cells overexpressing wild type or mutant MIR618 were established to investigate the effect of the variant rs2682818 and the function of MIR618 [PMC4695081]. A miR-618 mimic transfected into HeLa cells, followed by RIP-Chip analysis and network analysis, indicated a potential role for MIR618 in lymphomagenesis [PMC4695081]. The expression levels of miR692, miR620, and MIR618 were found to be inversely correlated with the degree of hepatocellular carcinoma (HCC) differentiation [PMC3575633].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUCUUGUUCACAGCCAAACUCUACUUGUCCUUCUGAGUGUAAUUACGUACAUGCAGUAGCUCAGGAGACAAGCAGGUUUACCCUGUGGAUGAGUCUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications