Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-30c precursor (hsa-mir-30c-1) secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-30c precursor (hsa-mir-30c-1) URS000075D43C_9606

  • 89 nucleotides
  • 8 databases (ENA, Ensembl, Ensembl/GENCODE, GeneCards, HGNC, MalaCards, miRBase, RefSeq)
  • Found in 58 species

Automated summary: This pre miRNA sequence is 89 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (ENA, HGNC, Ensembl/GENCODE, miRBase, Ensembl, GeneCards, MalaCards, RefSeq). Described in 52 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-30, RF00131). Homo sapiens (human) microRNA hsa-mir-30c precursor (hsa-mir-30c-1) sequence is a product of hsa-mir-30c-1 precursor, mir-30c-1 precurso, 30c-1, MIR30C1, mir-30c-1 precursor, ENSG00000207962.1, mir-30c-1, 1 genes. Found in the human reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    ACCAUGCUGUAGUGUGUGUAAACAUCCUACACUCUCAGCUGUGAGCUCAAGGUGGCUGGGAGAGGGUUGUUUACUCCUUCUGCCAUGGA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 57 other species

    1. Aotus nancymaae miRNA (ENSANAG00000005871.1)
    2. Callithrix jacchus (white-tufted-ear marmoset) miRNA (ENSCJAG00000025962.2)
    3. Cercocebus atys (Sooty mangabey) miRNA (ENSCATG00000021903.1)
    4. Choloepus hoffmanni microRNA 30c-1 (ENSCHOG00000015442.1)
    5. Colobus angolensis palliatus microRNA 30c-1 (ENSCANG00000016262.1)
    6. Dasypus novemcinctus (nine-banded armadillo) microRNA 30c-1 (ENSDNOG00000047698.1)
    7. Equus asinus asinus (donkey) microRNA 30c-1 (ENSEASG00005001058.1)
    8. Equus caballus microRNA eca-mir-30c precursor
    9. Gorilla gorilla gorilla microRNA 30c-1 (ENSGGOG00000031846.2)
    10. Loxodonta africana (African savanna elephant) microRNA 30c-1 (ENSLAFG00000023467.1)
    11. Macaca fascicularis miRNA (ENSMFAG00000017252.2)
    12. Macaca mulatta microRNA mml-mir-30c precursor (mml-mir-30c-1)
    13. Macaca nemestrina miRNA (ENSMNEG00000006234.1)
    14. Mandrillus leucophaeus (Drill) miRNA (ENSMLEG00000019593.1)
    15. Microcebus murinus (gray mouse lemur) miRNA (ENSMICG00000017952.3)
    16. Nomascus leucogenys miRNA (ENSNLEG00000025204.2)
    17. Otolemur garnettii miRNA (ENSOGAG00000018100.1)
    18. Pan paniscus miRNA (ENSPPAG00000018473.1)
    19. Pan troglodytes (chimpanzee) ptr-mir-30c-1 (ENSPTRG00000027608.2)
    20. Papio anubis miRNA (ENSPANG00000006717.2)
    21. Piliocolobus tephrosceles microRNA 30c-1 (ENSPTEG00000030204.1)
    22. Pongo abelii microRNA 30c-1 (ENSPPYG00000021726.1)
    23. Pongo pygmaeus microRNA ppy-mir-30c precursor (ppy-mir-30c-1)
    24. Prolemur simus (greater bamboo lemur) microRNA 30c-1 (ENSPSMG00000016668.1)
    25. Propithecus coquereli miRNA (ENSPCOG00000009632.1)
    26. Pteropus vampyrus microRNA 30c-1 (ENSPVAG00000026652.1)
    27. Rhinopithecus bieti miRNA (ENSRBIG00000014022.1)
    28. Rhinopithecus roxellana microRNA 30c-1 (ENSRROG00000008673.1)
    29. Saimiri boliviensis boliviensis miRNA (ENSSBOG00000000999.1)
    30. Theropithecus gelada microRNA 30c-1 (ENSTGEG00000024326.1)
    2D structure New