Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Danio rerio (zebrafish) microRNA dre-mir-454a precursor secondary structure diagram

Danio rerio (zebrafish) microRNA dre-mir-454a precursor URS000075D385_7955

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

dre-mir-454a: Dre-mir-454a is a candidate endogenous reference gene that was investigated for its suitability in a study [PMC8613261]. Normfinder software ranked dre-mir-454a as the third most stable gene among the preselected candidates [PMC8613261]. However, when expression data from MTZ treatments was considered, dre-mir-454a moved to the seventh position in the ranking [PMC8613261]. Additionally, when looking at three different strains, dre-mir-454a ranked fourth among the candidates [PMC8613261]. These rankings indicate that dre-mir-454a may not be as stable as other candidate reference genes in certain experimental conditions. The study aimed to identify suitable endogenous reference genes and investigated a total of nine candidates, including dre-mir-454a, for their suitability [PMC8613261]. The findings suggest that while dre-mir-454a may not be the most stable reference gene in all conditions, it could still be considered as a potential reference gene depending on the specific experimental context. Further research is needed to validate its stability and suitability in different experimental settings.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUGCAGGUCGUUUAAGAAUUAAUCCUAAUUCUUGGGACCCUAUCAGUAUUGCCUCUGCUGUCCACUGUGUUCAGAGUAGUGCAAUAUUGCUAAUAGGGUUUUAGGUUUUAGGUUGUACCUUCAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications