Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-380 precursor URS000075D37E_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR380: MIR380 is a microRNA that has been shown to attenuate p53 signaling in neuroblastoma and is transcribed from the maternal chromosome along the Rian extension of the Dlk1-Dio3 imprinted domain [PMC8044846] [PMC3919614]. Inhibitory experiments have demonstrated that HDAC3 plays a regulatory role in mesenchymal stem cells (MSCs) by stimulating the expression of Tumor Susceptibility Gene 101 (TSG101) and increasing the content of MIR380 and miR382 in MSC-derived exosomes [PMC8044846]. miR382 is overexpressed in multiple myeloma (MM) patients and targets tumor suppressor genes involved in tumor proliferation and survival, suggesting a pathogenetic function for this microRNA [PMC8044846] [PMC6883144]. Knockdown of HDAC3 leads to a decrease in exosomal expression of MIR380, miR382, as well as other pro-survival microRNAs such as miR15b, miR9986, and miR5191, resulting in cell growth arrest [PMC8392438] [PMC6883144]. Co-culturing MM cells with HDAC3-expressing cells leads to increased expression of pro-survival microRNAs including MIR380 and miR382 in exosomes derived from MM cells [PMC6883144]. These findings suggest that MIR380 and miR382 may have important roles in regulating cell survival and proliferation, particularly in the context of neuroblastoma and MM.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAGAUGGUUGACCAUAGAACAUGCGCUAUCUCUGUGUCGUAUGUAAUAUGGUCCACAUCUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5 other species

Publications