v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) PTPRD antisense RNA 1 (PTPRD-AS1) URS000075D31A_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

PTPRD-AS1: PTPRD-AS1, an immune-related biomarker, has been identified as a predictor of overall survival and immunotherapeutic response in bladder cancer [PMC9197617]. A prognostic model was developed using a risk scoring method based on the expression levels of eight lncRNAs, including PTPRD-AS1 [PMC5078024]. The risk score formula for survival prediction is as follows: Risk score= (−0.28051 × expression value of RP4-799P18.3) + (0.270976 × expression value of PTPRD-AS1) + (−0.211224× expression value of RP11-57P19.1) + (−0.239482 × expression value of RP11-307C12.11) + (−0.445144 × expression value of RP11-254I22.1) + (0.245869 × expression value of RP11-80H5.7) + (−0.295698 × expression value of RP1-223E5.4) + (−0.114835× expression value of GACAT3) [PMC5078024]. This model allows for the prediction and assessment of survival outcomes in bladder cancer patients based on the relative contributions and expressions levels of these lncRNAs [PMC5078024]. The inclusion and significance of PTPRD-AS1 in this prognostic model highlights its potential as a valuable biomarker for predicting patient outcomes and response to immunotherapy in bladder cancer [PMC9197617].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CUCCUCCUCCCGCUCCUCCUGCUCGCCCUGCGCCCGCUUCUCUCGCUGCCGCCGCCGCCGCUGUUUGUCUCCUCCCCCUCCUCCUCCUCCUCCUCUUCCUCCUCCUCCCGCUCCUCGAUGCUCCGCCGCUCGCGGCUGGGGGGUCCGGGGCCGCGUCUCCUCUCCUCCCUCCGCCUCUCCUCUUUCCUCCUUCCUGCUGCCUCUUCUUUUAAAGCGGAUUCUUUGGCCACAAAUAGCAACUCGGCUGCCCCCCUCGGUGCCUCCCUCCCCUUCUCUUCUUCCCCCCAAAAGUGAAGCGCACGCGAGGAGCUGAAAAGCUGUGCAGGGAUGAUGGACCCUUGCCCCCUGUGACCUAAGGAUGGAUCCAGAAAUCUCAGCCUCCCCAUAGGUAAAGAAACGAAGACCCUGAGAAUUUAAAAUCAUCCAACUAUUUGGUGCCAGAAGCAGGACAAGAACUCAGACAUCAUGAUCCAGUGCCCUCCAUCCCACCAGCUAUUCAUCAUCACCUCCACAUUCUGGAUCAAAGAAGCCAGUUUUCCAACUUAUCAAUGAGCAAUACAUAUAGAAUAUUUUUAAAACUCCAAAUACUUUUAUGAAGGAAAAAUGAAGCAAUAGGACAAGACAUUUUCUUCGUUUCCUUCCAGCUCUAACAUUCUGUGAUAAAUAGCACACAGGAGCUUUGCUAUAGCACUACCCCCUCUAGUGCAUAAUUCAGCAUACGAUGAGUAUGAGUCUGUUUUGGACCCCAUCCAAAGGAGUUAGUUCCUAGAAGUACUUGGAAGAUUUAUUCUCAUUUAUCAUGAGGCAUCCUAACAGGAGACUAAAAAUAAUCACGAUGACAAUAAUAGUAAUCAGUUGUUACACUUGUAUUAUGUACUAAGCAUCGUGCUAAGCAUGUUAAAGUUCACCUGUUUUUGAAAAGGCACUUCAUGACCUUAUGUGGGUUGCGAAUCUAGUGGGUCAUAAACAAUUUCUGAAAUGAAAGAAAAGUAGGAAAAAACACAGAGUGCAUUAUACAUACUAAGUUGUUUUAUUUUUUAUUUUUUUAUUUUUUUUGCAAAACUUCCUUUUUGAUCAUGUGGCUAGUGAUUAAAAGUUUGGAAGCACUGCCUCGUUUCCAAUCUUAACUGCCUUGCUAGUUAAGUAUUAUUAGCCCCAUUAUAUAAGUGAGGAAACAGGACGAGAGAGGAUAAGUAAUUUGGCCAAGCUGACACAGUGAGUGGCCAAGCUAGAAUUUUGAACCUAGAUCUGUUUGACUUCAAAUCCAAUAUUUUCACUUCUAUAGUGAUGAUAAAUUAUUGACCAAGGUAUGGAAUAAAUUGUUGCUAAUCAUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications