Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-1204 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-1204 precursor URS000075D2B1_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-1204: Hsa-mir-1204 is one of several miRNAs encoded by the non-coding RNA PVT1 [PMC3140991]. However, the expression of hsa-mir-1204 was found to be low or undetectable in both normal and tumor prostate samples [PMC3140991]. In seminoma, hsa-mir-1204 and its target gene CENPA were both upregulated, and hsa-mir-1204 overexpression promoted GLUT-1 expression, glucose uptake, and ATP production [PMC6797975]. The expression levels of hsa-mir-1204 were also significantly high in ovarian cancer patients and positively correlated with GLUT-1 expression [PMC6797975]. Hsa-mir-1204 was significantly correlated with tumor size in breast cancer and ovarian carcinoma cell lines [PMC6797975] [PMC4650632]. Hsa-mir-1204 was found to be involved in different pathways in different cell lines, such as 'Steroid hormone biosynthesis' and 'Cell cycle' [PMC4650632]. Hsa-mir-1204 was also identified as one of the miRNAs associated with overall survival-related mRNAs in a subnetwork analysis [PMC8568708]. In addition, hsa-mir-1204 is one of the miRNA candidates observed to have hits based on filtration criteria [PMC8288231]. The PVT1 oncogene, which encodes hsa-mir-1204, is associated with MYC activation through classic or variant translocations [PMC3063410].\

MIR1204: MIR1204 is a microRNA located on chromosome 8q24.21, 100 to 500 kb 3‐prime of MYC, and is part of the PVT1 gene cluster [PMC4770238] [PMC9562672] [PMC9102754]. It has been shown to be overexpressed and defined as oncogenic [PMC4172193]. MIR1204 plays an antiproliferative role and is a functional target of p53 at the PVT1 locus [PMC4172193]. Co-amplification of PVT1 and MIR1204 with MYC has been reported in several types of cancers, suggesting their oncogenic roles [PMC3806277]. PVT1-MYC fusions involving PVT1 exon1 and MIR1204 have been detected in medulloblastomas with MYC amplification [PMC3806277]. The MIR1204 gene was found to be hypomethylated in tumor samples compared to normal tissues [PMC8656781]. Association between MIR1204 and tumor growth suppression has also been suggested [PMC4692059] [PMC6160183]. The expression of MIR1204 was found to be lower in 5-FU-sensitive cell lines compared to resistant cell lines, suggesting its potential role in drug response [PMC4692059].\

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACCUCGUGGCCUGGUCUCCAUUAUUUGAGAUGAGUUACAUCUUGGAGGUGAGGACGUGCCUCGUGGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

2D structure Publications