v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Tetraodon nigroviridis (spotted green pufferfish) Tni-Mir-724-P1-v1_5p (mature (guide)) URS000075D284_99883

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UUAAAGGGAAUUUGCGACUGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

  1. Cyprinus carpio (common carp) ccr-miR-724
  2. Danio rerio dre-miR-724
  3. Gadus morhua gmo-miR-724-5p
  4. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-724
  5. Ictalurus punctatus (channel catfish) ipu-miR-724
  6. Lepisosteus oculatus (spotted gar) Loc-Mir-724-v1_5p (mature (guide))
  7. Maylandia zebra (zebra mbuna) mze-miR-724
  8. Monopterus albus (swamp eel) Mal-Mir-724-P1-v1_5p (mature (guide))
  9. Neolamprologus brichardi (lyretail cichlid) nbr-miR-724
  10. Oreochromis niloticus (Nile tilapia) oni-miR-724
  11. Pundamilia nyererei pny-miR-724
  12. Salmo salar ssa-miR-724-5p
  13. Tor tambroides miR-724