Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Danio rerio (zebrafish) dre-miR-724 URS000075D284_7955

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Danio rerio. Annotated by 4 databases (RefSeq, miRBase, ENA, MirGeneDB). Danio rerio (zebrafish) dre-miR-724 sequence is a product of dre-miR-724, miR-724, mir724 genes. Found in the zebrafish reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UUAAAGGGAAUUUGCGACUGUU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 13 other species

    1. Cyprinus carpio ccr-miR-724
    2. Gadus morhua (Atlantic cod) gmo-miR-724-5p
    3. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-724
    4. Ictalurus punctatus (channel catfish) ipu-miR-724
    5. Lepisosteus oculatus Loc-Mir-724-v1_5p (mature (guide))
    6. Maylandia zebra mze-miR-724
    7. Monopterus albus Mal-Mir-724-P1-v1_5p (mature (guide))
    8. Neolamprologus brichardi nbr-miR-724
    9. Oreochromis niloticus (Nile tilapia) oni-miR-724
    10. Pundamilia nyererei pny-miR-724
    11. Salmo salar (Atlantic salmon) ssa-miR-724-5p
    12. Tetraodon nigroviridis Tni-Mir-724-P1-v1_5p (mature (guide))
    13. Tor tambroides miR-724
    Publications New