Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oreochromis niloticus (Nile tilapia) oni-miR-153c URS000075D21E_8128

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUGCAUAGUCACAAAAAUGAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 8 other species

  1. Cyprinus carpio (common carp) ccr-miR-153b
  2. Danio rerio dre-miR-153b-3p
  3. Gadus morhua Gmo-Mir-153-P2a_3p (mature (guide))
  4. Ictalurus punctatus (channel catfish) ipu-miR-153b
  5. Monopterus albus (swamp eel) Mal-Mir-153-P2a_3p (mature (guide))
  6. Takifugu rubripes fru-miR-153b
  7. Tetraodon nigroviridis tni-miR-153b
  8. Tor tambroides miR-153b-3p