Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-3609 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-3609 precursor URS000075D1DB_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR3609: MIR3609 is a downregulated miRNA that has been identified as a potential biomarker for patients with locally advanced breast cancer [PMC9818474]. In kalirin–GEF1–inhibited cells, the miRNA precursors MIR181A2 and MIR3609 were found to be downregulated, which may explain the upregulation of miR-181 and miR-3609 targets [PMC8017594]. MIR3609 has been shown to improve the immune response in breast cancer by blocking the programmed death-ligand 1 immune checkpoint [PMC7527443]. Specifically, MIR3609 can bind to the 3′ UTR region of PD-L1 and suppress PD-L1 expression, thereby sensitizing breast cancer cells to doxorubicin [PMC9713762]. Functional analysis of downregulated miRNAs, including miR-24-2-5p, MIR3609, and miR-664b-3p, revealed that their target genes are involved in positive regulation processes such as cell morphogenesis, nervous system development, and neuron differentiation [PMC9727336]. Additionally, upregulation of MIR3609 has been shown to sensitize breast cancer cells to Adriamycin [PMC9727336]. Overall, these findings highlight the potential role of MIR3609 in breast cancer progression and treatment response.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUAACAGUAACUUUUAUUCUCAUUUUCCUUUUCUCUACCUUGUAGAGAAGCAAAGUGAUGAGUAAUACUGGCUGGAGCCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Gorilla gorilla gorilla microRNA 3609 (ENSGGOG00000039794.1)
2D structure Publications