v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens let-7f-2 stem-loop (hsa-let-7f-2) URS000075D19A_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIRLET7F2: MIRLET7F2 is a microRNA gene that is involved in a 122 kb maternal duplication of Xp11.22, along with MIR98 and HUWE1 genes [PMC9338470]. The Xp11.22 variant involving MIRLET7F2 and MIR98 genes may have potential epigenetic effects and requires further investigation [PMC9338470]. A custom gene panel was designed for mutation profiling of pediatric cancers, which includes MIRLET7F2 among 11 microRNA genes [PMC7341754]. MIRLET7F2 is expressed abundantly in lymphoid tumor cell lines [PMC9210832]. It is not targeted by several miRNAs, including members of the let-7 family such as MIRLET7A1, MIRLET7C, and MIRLET7F2, suggesting potential auto-regulation [PMC7961530]. The SureSelect custom kit was used for targeted capture in the study, which includes the detection of structural variations involving CD274, CTNNB1, ERG, ETV1, ETV4, EWSR1, FEV, FLI1 FOXO1 FUS INO80D NCOA1 NCOA2 NOTCH1 PAX3 PAX7 genes as well as promoter and enhancer regions of FGFR3 MYC TERT and microRNA genes including MIR100 to MIRLET7G [PMC7815088].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGUGGGAUGAGGUAGUAGAUUGUAUAGUUUUAGGGUCAUACCCCAUCUUGGAGAUAACUAUACAGUCUACUGUCUUUCCCACG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 91 other species

  1. Ailuropoda melanoleuca microRNA let-7f-2 (ENSAMEG00000020367.2)
  2. Aotus nancymaae (Ma's night monkey) miRNA (ENSANAG00000013900.1)
  3. Balaenoptera musculus microRNA let-7f-2 (ENSBMSG00010017822.1)
  4. Bison bison bison miRNA (ENSBBBG00000025145.1)
  5. Bos grunniens microRNA let-7f-2 (ENSBGRG00000026036.1)
  6. Bos indicus x Bos taurus miRNA (ENSBIXG00000000985.1, ENSBIXG00005012543.1)
  7. Bos mutus (wild yak) miRNA (ENSBMUG00000019622.1)
  8. Bos taurus let-7f-2 stem-loop (bta-let-7f-2)
  9. Callithrix jacchus (white-tufted-ear marmoset) miRNA (ENSCJAG00000026068.3)
  10. Camelus dromedarius (Arabian camel) microRNA let-7f-2 (ENSCDRG00005020650.1)
  11. Canis lupus dingo microRNA let-7f-2 (ENSCAFG00020019922.1)
  12. Canis lupus familiaris miRNA (ENSCAFG00030011319.1, ENSCAFG00040020857.1, ENSCAFG00845029544.1)
  13. Capra hircus microRNA let-7f-2 (ENSCHIG00000009131.1)
  14. Carlito syrichta (Philippine tarsier) miRNA (ENSTSYG00000023229.2)
  15. Castor canadensis (American beaver) miRNA (ENSCCNG00000026237.1)
  16. Catagonus wagneri (Chacoan peccary) microRNA let-7f-2 (ENSCWAG00000004511.1)
  17. Cavia porcellus microRNA let-7f-2 (ENSCPOG00000016453.3)
  18. Cebus imitator (Panamanian white-faced capuchin) microRNA let-7f-2 (ENSCCAG00000001762.1)
  19. Cercocebus atys miRNA (ENSCATG00000019072.1)
  20. Cervus elaphus hippelaphus ncRNA
  21. Cervus hanglu yarkandensis microRNA let-7f-2 (ENSCHYG00000016448.1)
  22. Chinchilla lanigera (Long-tailed chinchilla) microRNA let-7f-2 (ENSCLAG00000021167.1)
  23. Chlorocebus sabaeus (African green monkey) microRNA let-7f-2 (ENSCSAG00000027848.1)
  24. Choloepus hoffmanni (Hoffmann's two-fingered sloth) miRNA (ENSCHOG00000014188.1, ENSCHOG00000015230.1)
  25. Colobus angolensis palliatus miRNA (ENSCANG00000011429.1)
  26. Cricetulus griseus (Chinese hamster) miRNA (ENSCGRG00000021832.1, ENSCGRG00001007414.1, ENSCGRG00015021237.2)
  27. Dasypus novemcinctus (nine-banded armadillo) microRNA let-7f-2 (ENSDNOG00000027372.1)
  28. Delphinapterus leucas microRNA let-7f-2 (ENSDLEG00000017254.1)
  29. Equus asinus asinus microRNA let-7f-2 (ENSEASG00005017920.1)
  30. Equus asinus (ass) microRNA let-7f-2 (ENSEASG00005017920.2)
  31. Equus caballus (horse) microRNA let-7f-2 (ENSECAG00000025499.2)
  32. Erinaceus europaeus (western European hedgehog) microRNA let-7f-2 (ENSEEUG00000016161.1)
  33. Felis catus (domestic cat) microRNA let-7f-2 (ENSFCAG00000016684.3)
  34. Fukomys damarensis (Damara mole rat) miRNA (ENSFDAG00000020664.1)
  35. Gorilla gorilla gorilla microRNA let-7f-2 (ENSGGOG00000029666.2)
  36. Heterocephalus glaber (naked mole-rat) microRNA let-7f-2 (ENSHGLG00000022619.1, ENSHGLG00100024415.1)
  37. Ictidomys tridecemlineatus microRNA let-7f-2 (ENSSTOG00000016643.1)
  38. Lynx canadensis (Canada lynx) microRNA let-7f-2 (ENSLCNG00005018112.1)
  39. Macaca fascicularis microRNA let-7f-2 (ENSMFAG00000012563.2)
  40. Macaca mulatta let-7f-2 stem-loop (mml-let-7f-2)
  41. Macaca nemestrina (Pig-tailed macaque) miRNA (ENSMNEG00000002894.1)
  42. Mandrillus leucophaeus (Drill) miRNA (ENSMLEG00000013930.1)
  43. Marmota marmota marmota microRNA let-7f-2 (ENSMMMG00000013076.1)
  44. Mesocricetus auratus (Golden Hamster) miRNA (ENSMAUG00000007660.1)
  45. Microcebus murinus (gray mouse lemur) microRNA let-7f-2 (ENSMICG00000019044.3)
  46. Microtus ochrogaster (vole) microRNA let7f-2 (ENSMOCG00000010883.1)
  47. Monodon monoceros (narwhal) microRNA let-7f-2 (ENSMMNG00015015390.1)
  48. Moschus moschiferus (Siberian musk deer) microRNA let-7f-2 (ENSMMSG00000006487.1)
  49. Mus caroli microRNA let7f-2 (MGP_CAROLIEiJ_G0008405.1)
  50. Mus musculus let-7f-2 stem-loop (mmu-let-7f-2)
  51. Mus pahari microRNA let7f-2 (MGP_PahariEiJ_G0007911.1)
  52. Mus spicilegus (steppe mouse) microRNA let7f-2 (ENSMSIG00000005628.1)
  53. Mus spretus (algerian mouse) microRNA let7f-2 (MGP_SPRETEiJ_G0008858.1)
  54. Mustela putorius furo (Domestic ferret) miRNA (ENSMPUG00000021088.1)
  55. Myotis lucifugus microRNA let-7f-2 (ENSMLUG00000017886.1)
  56. Nannospalax galili microRNA let7f-2 (ENSNGAG00000005112.1)
  57. Neogale vison miRNA (ENSNVIG00000023335.1)
  58. Nomascus leucogenys (Northern white-cheeked gibbon) microRNA let-7f-2 (ENSNLEG00000024239.2)
  59. Octodon degus microRNA let-7f-2 (ENSODEG00000021847.1)
  60. Oryctolagus cuniculus (rabbit) ocu-let-7f-2 (ENSOCUG00000018373.1)
  61. Otolemur garnettii (small-eared galago) miRNA (ENSOGAG00000017482.1)
  62. Ovis aries let-7f stem-loop (oar-let-7f)
  63. Pan paniscus (bonobo) microRNA let-7f-2 (ENSPPAG00000008771.1)
  64. Panthera leo (lion) microRNA let-7f-2 (ENSPLOG00000020215.1)
  65. Panthera pardus microRNA let-7f-2 (ENSPPRG00000014512.1)
  66. Panthera tigris altaica miRNA (ENSPTIG00000001710.1)
  67. Pan troglodytes ptr-let-7f-2 (ENSPTRG00000027569.2)
  68. Papio anubis miRNA (ENSPANG00000003320.3)
  69. Phocoena sinus microRNA let-7f-2 (ENSPSNG00000016961.1)
  70. Physeter catodon (sperm whale) microRNA let-7f-2 (ENSPCTG00005016753.1)
  71. Piliocolobus tephrosceles (Ugandan red Colobus) miRNA (ENSPTEG00000002733.1)
  72. Pongo abelii miRNA (ENSPPYG00000021638.2)
  73. Pongo pygmaeus let-7f-2 stem-loop (ppy-let-7f-2)
  74. Prolemur simus miRNA (ENSPSMG00000018384.1)
  75. Propithecus coquereli (Coquerel's sifaka) miRNA (ENSPCOG00000009398.1)
  76. Rattus norvegicus let-7f-2 stem-loop (rno-let-7f-2)
  77. Rhinolophus ferrumequinum (greater horseshoe bat) microRNA let-7f-2 (ENSRFEG00010002213.1)
  78. Rhinopithecus bieti miRNA (ENSRBIG00000008997.1)
  79. Rhinopithecus roxellana miRNA (ENSRROG00000003258.1)
  80. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) miRNA (ENSSBOG00000018497.1)
  81. Spermophilus dauricus miRNA (ENSSDAG00000013691.1)
  82. Suricata suricatta microRNA let-7f-2 (ENSSSUG00005018886.1)
  83. Sus scrofa let-7f-1 stem-loop (ssc-let-7f-1)
  84. Theropithecus gelada (gelada) microRNA let-7f-2 (ENSTGEG00000028099.1)
  85. Tupaia belangeri microRNA let-7f-2 (ENSTBEG00000017776.1)
  86. Tursiops truncatus (bottlenosed dolphin) miRNA (ENSTTRG00000023820.1)
  87. Urocitellus parryii microRNA let-7f-2 (ENSUPAG00010001378.1)
  88. Ursus americanus miRNA (ENSUAMG00000023707.1)
  89. Ursus maritimus miRNA (ENSUMAG00000022831.1)
  90. Ursus thibetanus thibetanus (Asiatic black bear) microRNA let-7f-2 (ENSUTTG00000022423.1)
  91. Vicugna pacos (alpaca) miRNA (ENSVPAG00000016874.1)
  92. Vulpes vulpes miRNA (ENSVVUG00000029874.1)
  93. Zalophus californianus (california sea lion) miRNA (ENSZCAG00015014751.1)
 Publications