Chrysolophus pictus (golden pheasant) microRNA 219b (ENSCPIG00010014972.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Chrysolophus pictus (golden pheasant) microRNA 219b (ENSCPIG00010014972.1) URS000075D178_9089

89 nucleotides
1 database (Ensembl)
Found in 5 other species
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

AAUCUCUGCUACAGAUGUCCAGACACAAUUCUUGGUUCGUACGGCUCCAGCGCACAAGAAUUGCGUUUGGACAAUCAGGAGCAGAGAUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5 other species

Coturnix japonica (Japanese quail) microRNA 219b (ENSCJPG00005019943.1)
Gallus gallus microRNA gga-mir-219b precursor
Pavo cristatus (Indian peafowl) microRNA 219b (ENSPSTG00000000021.1)
Phasianus colchicus microRNA 219b (ENSPCLG00000013075.1)