Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) microRNA gga-mir-219b precursor URS000075D178_9031

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

gga-mir-219b: gga-mir-219b is a type of microRNA that is downregulated in tumorous spleen and liver compared to non-tumorous samples [PMC5484716]. It has been found to inhibit the proliferation, migration, and invasion of MSB-1 cells by targeting the B-cell chronic lymphoma 11B (BCL11B) gene [PMC6862082]. The interaction between gga-mir-219b and BCL11B was confirmed through experiments that showed gga-mir-219b overexpression and BCL11B knockdown induced tumor cell apoptosis [PMC5484716]. The binding site for gga-mir-219b on BCL11B was identified as the 461–467 site in the seed region [PMC5484716]. The effect of gga-mir-219b on cell invasion was evaluated by examining the expression levels of MMP2 and MMP9, which are genes associated with cell invasion [PMC5484716]. It was found that gga-mir-219b overexpression and BCL11B knockdown inhibited migration of MSB1 cells [PMC5484716]. Luciferase reporter assays confirmed that BCL11B is a direct target gene of gga-mir-219b [PMC5484716]. Furthermore, gga-mir-219b has been shown to affect gene expression in apoptosis pathways, including the mitochondrial pathway and death receptor pathway [PMC5484716]. Overall, gga-mir-219b acts as a tumor suppressor by inhibiting tumor cell proliferation, apoptosis, migration, and invasion through its interaction with BCL11B [PMC5484716][PMC6862082][PMC9693605][PMC9721073].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAUCUCUGCUACAGAUGUCCAGACACAAUUCUUGGUUCGUACGGCUCCAGCGCACAAGAAUUGCGUUUGGACAAUCAGGAGCAGAGAUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

Publications