Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-125a precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-125a precursor URS000075D168_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR125A: ROC curve analysis was performed to assess the diagnostic accuracy of MIR125A, miR146B, miR221, and miR4324 in distinguishing papillary thyroid carcinoma (PTC) from benign thyroid nodules [PMC9221779]. MIR125A targets the expression of Clec5a/MDL1, a protein that is crucial for granulocytic differentiation [PMC4335136]. The inhibition of granulocytic differentiation induced by ASXL1-MT in 32D cells was rescued by Clec5a expression [PMC4335136].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGCCAGUCUCUAGGUCCCUGAGACCCUUUAACCUGUGAGGACAUCCAGGGUCACAGGUGAGGUUCUUGGGAGCCUGGCGUCUGGCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

2D structure Publications