Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-3922 precursor URS000075D152_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR3922: MIR3922 is a microRNA located within the CHST11 locus at 12q23 and is nullizygous in the proband [PMC4585449]. The expression and function of MIR3922 in lymphocytes, both alone and in combination with reduced expression of CHST11, have been assessed [PMC4585449]. The homozygous deletion of CHST11 and MIR3922 has been identified by whole-genome sequencing (WGS) of DNA from the proband's cultured fibroblast cells [PMC4585449]. This deletion was confirmed by testing the proband's DNA from both her cultured fibroblasts and buccal epithelia simultaneously using droplet digital PCR (ddPCR) [PMC4585449]. It is speculated that loss of MIR3922 contributes to the lymphoproliferative phenotype observed in the proband [PMC4585449]. The deletion includes exon 2 of CHST11 as well as MIR3922 [PMC4585449]. Computational prediction suggests that MIR3922 may target ZNF585A and/or ERBB2 [PMC4585449]. It is hypothesized that CHST11 and/or MIR3922 may act as tumor suppressors in the lymphocyte lineage [PMC4585449]. Genotyping using highly polymorphic short tandem repeats (STRs) confirmed that deletion of CHST11 and MIR3922 was present in the constitutional genome of the proband, ruling out a culture artifact as a cause for this deletion [PMC4585449]. The unaffected siblings did not show homozygous deletion of CHST11 and MIR3922, indicating a potential role for these genes in the combined phenotype observed in the proband [PMC4585449].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGAAGAGUCAAGUCAAGGCCAGAGGUCCCACAGCAGGGCUGGAAAGCACACCUGUGGGACUUCUGGCCUUGACUUGACUCUUUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications