Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) microRNA bta-mir-9 precursor (bta-mir-9-1) URS000075D147_9913

Automated summary: This pre miRNA sequence is 90 nucleotides long and is found in Bos taurus. Annotated by 4 databases (RefSeq, Ensembl, ENA, miRBase). Described in 8 papers. Matches 1 Rfam family (mir-9, RF00237). Bos taurus (cattle) microRNA bta-mir-9 precursor (bta-mir-9-1) sequence is a product of bta-mir-9-1 precursor, MIR9-1, mir-9-1 precursor, mir-9-1, 9-1, mir-9-1 precurso, ENSBTAG00000029922.3 genes. Found in the cattle reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GGAGGCCCGUUUCUCUCUUUGGUUAUCUAGCUGUAUGAGUGCCACAGAGCCGUCAUAAAGCUAGAUAACCGAAAGUAGAAAUGACUCUCA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 137 other species

    1. Ailuropoda melanoleuca (giant panda) microRNA 9-3 (ENSAMEG00000022876.2)
    2. Balaenoptera musculus miRNA (ENSBMSG00010003656.1)
    3. Bison bison bison (American bison) miRNA (ENSBBBG00000024697.1)
    4. Bos grunniens microRNA 9-3 (ENSBGRG00000005109.1)
    5. Bos indicus x Bos taurus microRNA 9-3 (ENSBIXG00000006341.1, ENSBIXG00005020246.1)
    6. Bos mutus miRNA (ENSBMUG00000006374.1)
    7. Camelus dromedarius microRNA 9-3 (ENSCDRG00005020624.1)
    8. Canis lupus dingo (dingo) microRNA 9-3 (ENSCAFG00020018474.1)
    9. Canis lupus familiaris miRNA (ENSCAFG00000020511.2, ENSCAFG00030002774.1, ENSCAFG00040001334.1)
    10. Capra hircus microRNA mir-9 (ENSCHIG00000009559.1, ENSCHIG00010011586.1)
    11. Castor canadensis (American beaver) miRNA (ENSCCNG00000024740.1)
    12. Catagonus wagneri (Chacoan peccary) microRNA 9-3 (ENSCWAG00000013550.1)
    13. Cavia porcellus microRNA 9-3 (ENSCPOG00000025678.2)
    14. Cercocebus atys miRNA (ENSCATG00000017552.1)
    15. Cervus hanglu yarkandensis (Yarkand deer) miRNA (ENSCHYG00000012717.1)
    16. Chinchilla lanigera (Long-tailed chinchilla) miRNA (ENSCLAG00000020911.1)
    17. Chlorocebus sabaeus miRNA (ENSCSAG00000024670.1)
    18. Cricetulus griseus microRNA 9-3 (ENSCGRG00001005866.1, ENSCGRG00015001283.1)
    19. Delphinapterus leucas microRNA 9-3 (ENSDLEG00000009509.1)
    20. Equus asinus asinus (donkey) miRNA (ENSEASG00005015224.1)
    21. Equus caballus miRNA (ENSECAG00000028729.1)
    22. Felis catus miRNA (ENSFCAG00000024120.3)
    23. Gorilla gorilla gorilla (Western Lowland Gorilla) microRNA 9-3 (ENSGGOG00000031893.2)
    24. Ictidomys tridecemlineatus miRNA (ENSSTOG00000016639.1)
    25. Lynx canadensis (Canada lynx) microRNA 9-3 (ENSLCNG00005004034.1)
    26. Macaca fascicularis (Crab-eating macaque) miRNA
    27. Macaca mulatta microRNA mml-mir-9 precursor (mml-mir-9-3)
    28. Macaca nemestrina (Pig-tailed macaque) miRNA (ENSMNEG00000021025.1)
    29. Mandrillus leucophaeus (Drill) miRNA (ENSMLEG00000014313.1)
    30. Marmota marmota marmota (Alpine marmot) microRNA 9-3 (ENSMMMG00000020016.1)
    31. Meriones unguiculatus (Mongolian gerbil) miRNA (ENSMUGG00000015073.1, ENSMUGG00000015129.1)
    32. Microcebus murinus (gray mouse lemur) miRNA (ENSMICG00000018623.3)
    33. Microtus ochrogaster (vole) microRNA 9-3 (ENSMOCG00000004367.1)
    34. Monodon monoceros miRNA (ENSMMNG00015008467.1)
    35. Moschus moschiferus microRNA 9-3 (ENSMMSG00000023959.1)
    36. Mus caroli microRNA 9-3 (MGP_CAROLIEiJ_G0008128.1)
    37. Mus musculus (house mouse) microRNA mmu-mir-9 precursor (mmu-mir-9-3)
    38. Mus pahari (Shrew mouse) microRNA 9-3 (MGP_PahariEiJ_G0006567.1)
    39. Mus spicilegus (steppe mouse) miRNA (ENSMSIG00000018230.1)
    40. Mus spretus microRNA 9-3 (MGP_SPRETEiJ_G0008553.1)
    41. Mustela putorius furo miRNA (ENSMPUG00000023502.1)
    42. Nannospalax galili (Upper Galilee mountains blind mole rat) miRNA (ENSNGAG00000004726.1)
    43. Neovison vison miRNA (ENSNVIG00000017656.1)
    44. Nomascus leucogenys miRNA (ENSNLEG00000026261.2)
    45. Octodon degus miRNA (ENSODEG00000021787.1)
    46. Otolemur garnettii miRNA (ENSOGAG00000030461.1)
    47. Ovis aries miRNA (ENSOARG00020011073.1)
    48. Pan paniscus miRNA (ENSPPAG00000005450.1)
    49. Panthera leo (lion) microRNA 9-3 (ENSPLOG00000021134.1)
    50. Panthera pardus microRNA 9-3 (ENSPPRG00000013958.1)
    51. Pan troglodytes miRNA (ENSPTRG00000032335.3)
    52. Papio anubis (Olive baboon) miRNA (ENSPANG00000001172.2)
    53. Peromyscus maniculatus bairdii (Northern American deer mouse) microRNA 9-3 (ENSPEMG00000002527.2)
    54. Phocoena sinus (vaquita) miRNA (ENSPSNG00000003068.1)
    55. Physeter catodon (sperm whale) microRNA 9-3 (ENSPCTG00005002298.1)
    56. Piliocolobus tephrosceles (Ugandan red Colobus) miRNA (ENSPTEG00000000103.1)
    57. Pongo abelii microRNA 9-3 (ENSPPYG00000022331.1)
    58. Pongo pygmaeus microRNA ppy-mir-9 precursor (ppy-mir-9-3)
    59. Prolemur simus (greater bamboo lemur) miRNA (ENSPSMG00000008771.1)
    60. Propithecus coquereli miRNA (ENSPCOG00000000642.1)
    61. Rhinolophus ferrumequinum (greater horseshoe bat) microRNA 9-3 (ENSRFEG00010007593.1)
    62. Rhinopithecus bieti (Black snub-nosed monkey) miRNA (ENSRBIG00000011985.1)
    63. Rhinopithecus roxellana miRNA (ENSRROG00000026428.1)
    64. Sciurus vulgaris miRNA (ENSSVLG00005004188.1)
    65. Sus scrofa (pig) ssc-mir-9-3 (multiple genes)
    66. Theropithecus gelada microRNA 9-3 (ENSTGEG00000007473.1)
    67. Tupaia belangeri miRNA (ENSTBEG00000017887.1)
    68. Urocitellus parryii miRNA (ENSUPAG00010016050.1)
    69. Ursus americanus (American black bear) miRNA (ENSUAMG00000017533.1)
    70. Ursus thibetanus thibetanus (Asiatic black bear) microRNA 9-3 (ENSUTTG00000010469.1)
    71. Vulpes vulpes (red fox) miRNA (ENSVVUG00000011384.1)
    72. Zalophus californianus (california sea lion) miRNA (ENSZCAG00015006428.1)