Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pan troglodytes (chimpanzee) miRNA (ENSPTRG00000032335.3) URS000075D147_9598

Automated summary: This miRNA sequence is 90 nucleotides long and is found in Pan troglodytes. Annotated by 2 databases (ENA, Ensembl). Described in 1 paper. Matches 1 Rfam family (mir-9, RF00237). Pan troglodytes (chimpanzee) miRNA (ENSPTRG00000032335.3) sequence is a product of ENSPTRG00000032335.3 gene. Found in the chimpanzee reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GGAGGCCCGUUUCUCUCUUUGGUUAUCUAGCUGUAUGAGUGCCACAGAGCCGUCAUAAAGCUAGAUAACCGAAAGUAGAAAUGACUCUCA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 191 other species

    1. Ailuropoda melanoleuca microRNA 9-3 (ENSAMEG00000022876.2)
    2. Balaenoptera musculus (Blue whale) miRNA MIR9-3 (ENSBMSG00010003656.1)
    3. Bison bison bison miRNA (ENSBBBG00000024697.1)
    4. Bos grunniens microRNA 9-3 (ENSBGRG00000005109.1)
    5. Bos indicus x Bos taurus microRNA 9-3 (ENSBIXG00000006341.1, ENSBIXG00005020246.1)
    6. Bos mutus miRNA (ENSBMUG00000006374.1)
    7. Bos taurus microRNA bta-mir-9 precursor (bta-mir-9-1)
    8. Camelus dromedarius microRNA 9-3 (ENSCDRG00005020624.1)
    9. Canis lupus dingo microRNA 9-3 (ENSCAFG00020018474.1)
    10. Canis lupus familiaris miRNA (ENSCAFG00000020511.3, ENSCAFG00030002774.1, ENSCAFG00040001334.1, ENSCAFG00845000227.1)
    11. Capra hircus microRNA mir-9 (ENSCHIG00000009559.1, ENSCHIG00010011586.1)
    12. Castor canadensis (American beaver) miRNA (ENSCCNG00000024740.1)
    13. Catagonus wagneri (Chacoan peccary) microRNA 9-3 (ENSCWAG00000013550.1)
    14. Cavia porcellus microRNA 9-3 (ENSCPOG00000025678.2)
    15. Cercocebus atys miRNA (ENSCATG00000017552.1)
    16. Cervus hanglu yarkandensis (Yarkand deer) miRNA MIR9-3 (ENSCHYG00000012717.1)
    17. Chinchilla lanigera (Long-tailed chinchilla) miRNA (ENSCLAG00000020911.1)
    18. Chlorocebus sabaeus (African green monkey) miRNA MIR9-3 (ENSCSAG00000024670.1)
    19. Cricetulus griseus microRNA 9-3 (ENSCGRG00001005866.1, ENSCGRG00015001283.1)
    20. Delphinapterus leucas microRNA 9-3 (ENSDLEG00000009509.1)
    21. Equus asinus asinus (donkey) miRNA (ENSEASG00005015224.1)
    22. Equus caballus (horse) microRNA 9-3 (ENSECAG00000028729.1)
    23. Felis catus microRNA 9-3 (ENSFCAG00000024120.3)
    24. Gorilla gorilla gorilla microRNA 9-3 (ENSGGOG00000031893.2)
    25. Ictidomys tridecemlineatus (thirteen-lined ground squirrel) miRNA (ENSSTOG00000016639.1)
    26. Lynx canadensis (Canada lynx) microRNA 9-3 (ENSLCNG00005004034.1)
    27. Macaca fascicularis (Crab-eating macaque) miRNA
    28. Macaca mulatta (Rhesus monkey) microRNA mml-mir-9 precursor (mml-mir-9-3)
    29. Macaca nemestrina (Pig-tailed macaque) miRNA (ENSMNEG00000021025.1)
    30. Mandrillus leucophaeus (Drill) miRNA (ENSMLEG00000014313.1)
    31. Marmota marmota marmota (Alpine marmot) microRNA 9-3 (ENSMMMG00000020016.1)
    32. Meriones unguiculatus miRNA (ENSMUGG00000015073.1, ENSMUGG00000015129.1)
    33. Microcebus murinus microRNA 9-3 (ENSMICG00000018623.3)
    34. Microtus ochrogaster (vole) microRNA 9-3 (ENSMOCG00000004367.1)
    35. Monodon monoceros microRNA 9-3 (ENSMMNG00015008467.1)
    36. Moschus moschiferus (Siberian musk deer) microRNA 9-3 (ENSMMSG00000023959.1)
    37. Mus caroli (Ryukyu mouse) microRNA 9-3 (MGP_CAROLIEiJ_G0008128.1)
    38. Mus musculus microRNA mmu-mir-9 precursor (mmu-mir-9-3)
    39. Mus pahari (Shrew mouse) microRNA 9-3 (MGP_PahariEiJ_G0006567.1)
    40. Mus spicilegus (steppe mouse) miRNA (ENSMSIG00000018230.1)
    41. Mus spretus (algerian mouse) microRNA 9-3 (MGP_SPRETEiJ_G0008553.1)
    42. Mustela putorius furo miRNA (ENSMPUG00000023502.1)
    43. Nannospalax galili (Upper Galilee mountains blind mole rat) miRNA (ENSNGAG00000004726.1)
    44. Neogale vison miRNA (ENSNVIG00000017656.1)
    45. Nomascus leucogenys miRNA (ENSNLEG00000026261.2)
    46. Octodon degus miRNA (ENSODEG00000021787.1)
    47. Otolemur garnettii miRNA (ENSOGAG00000030461.1)
    48. Ovis aries miRNA (ENSOARG00020011073.1)
    49. Pan paniscus (bonobo) miRNA (ENSPPAG00000005450.1)
    50. Panthera leo microRNA 9-3 (ENSPLOG00000021134.1)
    51. Panthera pardus (leopard) microRNA 9-3 (ENSPPRG00000013958.1)
    52. Papio anubis (olive baboon) miRNA (ENSPANG00000001172.3)
    53. Peromyscus maniculatus bairdii microRNA 9-3 (ENSPEMG00000002527.2)
    54. Phocoena sinus miRNA (ENSPSNG00000003068.1)
    55. Physeter catodon microRNA 9-3 (ENSPCTG00005002298.1)
    56. Piliocolobus tephrosceles miRNA (ENSPTEG00000000103.1)
    57. Pongo abelii (Sumatran orangutan) miRNA (ENSPPYG00000022331.2)
    58. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-9 precursor (ppy-mir-9-3)
    59. Prolemur simus (greater bamboo lemur) miRNA (ENSPSMG00000008771.1)
    60. Propithecus coquereli (Coquerel's sifaka) miRNA (ENSPCOG00000000642.1)
    61. Rhinolophus ferrumequinum microRNA 9-3 (ENSRFEG00010007593.1)
    62. Rhinopithecus bieti miRNA (ENSRBIG00000011985.1)
    63. Rhinopithecus roxellana miRNA (ENSRROG00000026428.1)
    64. Sciurus vulgaris (Eurasian red squirrel) miRNA (ENSSVLG00005004188.1)
    65. Sus scrofa ssc-mir-9-3 (multiple genes)
    66. Theropithecus gelada microRNA 9-3 (ENSTGEG00000007473.1)
    67. Tupaia belangeri (northern tree shrew) miRNA (ENSTBEG00000017887.1)
    68. Urocitellus parryii (Arctic ground squirrel) miRNA (ENSUPAG00010016050.1)
    69. Ursus americanus miRNA (ENSUAMG00000017533.1)
    70. Ursus thibetanus thibetanus microRNA 9-3 (ENSUTTG00000010469.1)
    71. Vulpes vulpes (red fox) miRNA (ENSVVUG00000011384.1)
    72. Zalophus californianus (california sea lion) miRNA (ENSZCAG00015006428.1)