Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) microRNA bta-mir-16b precursor URS000075D0CB_9913

Automated summary: This pre miRNA sequence is 93 nucleotides long and is found in Bos taurus. Annotated by 4 databases (miRBase, RefSeq, Ensembl, ENA). Described in 7 papers. Matches 1 Rfam family (mir-16, RF00254). Bos taurus (cattle) microRNA bta-mir-16b precursor sequence is a product of 16b, mir-16b precurso, bta-mir-16b, bta-mir-16b precursor, mir-16b, mir-16b precursor, 16, MIR16B genes. Found in the cattle reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CAUACUUGUUCCGCUGUAGCAGCACGUAAAUAUUGGCGUAGUAAAAUAAAUAUUAAACACCAAUAUUAUUGUGCUGCUUUAGCGUGACAGGGA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 3 other species

    1. Bison bison bison (American bison) microRNA 16-2 (MIR16-2)
    2. Bos grunniens (domestic yak) microRNA 16-2
    3. Bos indicus x Bos taurus microRNA 16-2
    4. Bos mutus microRNA 16-2 (MIR16-2)