Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-485 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-485 precursor URS000075D081_9606

  • 73 nucleotides
  • 8 databases (ENA, Ensembl, Ensembl/GENCODE, GeneCards, HGNC, MalaCards, miRBase, RefSeq)
  • Found in 25 species

Automated summary: This pre miRNA sequence is 73 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (MalaCards, Ensembl, RefSeq, miRBase, HGNC, Ensembl/GENCODE, GeneCards, ENA). Described in 43 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-154, RF00641). Homo sapiens (human) microRNA hsa-mir-485 precursor sequence is a product of mir-485, mir-485 precurso, MIR485, hsa-mir-485 precursor, mir-485 precursor genes. Found in the human reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    ACUUGGAGAGAGGCUGGCCGUGAUGAAUUCGAUUCAUCAAAGCGAGUCAUACACGGCUCUCCUCUCUUUUAGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 24 other species

    1. Aotus nancymaae miRNA
    2. Cercocebus atys (Sooty mangabey) miRNA
    3. Colobus angolensis palliatus microRNA 485
    4. Fukomys damarensis (Damara mole rat) miRNA
    5. Gorilla gorilla gorilla (Western Lowland Gorilla) microRNA 485
    6. Jaculus jaculus miRNA
    7. Macaca fascicularis (Crab-eating macaque) miRNA
    8. Macaca mulatta microRNA mml-mir-485 precursor
    9. Macaca nemestrina miRNA
    10. Mandrillus leucophaeus (Drill) miRNA
    11. Microcebus murinus miRNA
    12. Mustela putorius furo (Domestic ferret) miRNA
    13. Myotis lucifugus microRNA 485
    14. Nannospalax galili miRNA
    15. Nomascus leucogenys (Northern white-cheeked gibbon) miRNA
    16. Otolemur garnettii (small-eared galago) miRNA
    17. Pan paniscus (bonobo) miRNA
    18. Pan troglodytes (chimpanzee) ptr-mir-485
    19. Papio anubis (Olive baboon) miRNA
    20. Pongo abelii microRNA 485
    21. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-485 precursor
    22. Propithecus coquereli (Coquerel's sifaka) miRNA
    23. Rhinopithecus bieti miRNA
    24. Rhinopithecus roxellana miRNA
    25. Saimiri boliviensis boliviensis miRNA
    26. Vicugna pacos (alpaca) miRNA
    2D structure New