Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-485 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-485 precursor URS000075D081_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR485: MIR485 is a microRNA that has been studied in various contexts, including pancreatic cancer, viral infections, and muscle cell regulation. In pancreatic cancer cells, a genetically engineered adenovirus called ICOVIR15 was developed to code for MIR485 and miR99b, which enhanced viral propagation and increased antitumoral activity [PMC9171400]. MIR485 has been shown to target RIG-I mRNA for degradation, impairing the antiviral response and promoting replication of the influenza A virus [PMC6370596]. In muscle cells, MIR485 was found to be downregulated in satellite cells lacking ERα (scERαKO), which resulted in the upregulation of genes promoting cell death and downregulation of genes promoting cell survival [PMC6655560]. In various studies using different animal models, including dogs and mice, MIR485 was found to be differentially expressed in response to different conditions or treatments [PMC8376273] [PMC10001410] [PMC6122344] [PMC4482373]. Additionally, MIR485 has been implicated in modulating the canonical Wnt pathway by negatively regulating FZD4, RAC-1, PKC (88), SFRP1 levels and positively regulating STB1 levels [PMC5285348]. Furthermore, elevated levels of MIR485 were found in various organs after treatment compared to untreated groups [PMC4605239]. Finally, micro-RNA miR-485-5p transcript is known to be deregulated in Alzheimer's disease patients [PMC5546543].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACUUGGAGAGAGGCUGGCCGUGAUGAAUUCGAUUCAUCAAAGCGAGUCAUACACGGCUCUCCUCUCUUUUAGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 32 other species

  1. Aotus nancymaae (Ma's night monkey) microRNA 485 (ENSANAG00000013189.1)
  2. Camelus ferus (Wild Bactrian camel) mir-485 microRNA precursor family
  3. Cebus imitator (Panamanian white-faced capuchin) microRNA 485 (ENSCCAG00000015927.1)
  4. Cercocebus atys microRNA 485 (ENSCATG00000015441.1)
  5. Chlorocebus sabaeus mir-485 microRNA precursor family
  6. Colobus angolensis palliatus miRNA (ENSCANG00000037865.1)
  7. Eptesicus fuscus (big brown bat) mir-485 microRNA precursor family
  8. Fukomys damarensis (Damara mole rat) miRNA (ENSFDAG00000000135.1)
  9. Gorilla gorilla gorilla microRNA 485 (ENSGGOG00000034781.2)
  10. Gorilla gorilla (western gorilla) mir-485 microRNA precursor family
  11. Jaculus jaculus miRNA (ENSJJAG00000000688.1)
  12. Macaca mulatta microRNA mml-mir-485 precursor
  13. Macaca nemestrina (Pig-tailed macaque) microRNA 485 (ENSMNEG00000002055.1)
  14. Mandrillus leucophaeus (Drill) microRNA 485 (ENSMLEG00000012956.1)
  15. Microcebus murinus (gray mouse lemur) microRNA 485 (ENSMICG00000019372.3)
  16. Mustela putorius furo (Domestic ferret) miRNA (ENSMPUG00000020369.1)
  17. Myotis brandtii mir-485 microRNA precursor family
  18. Myotis davidii mir-485 microRNA precursor family
  19. Myotis lucifugus microRNA 485 (ENSMLUG00000018093.1)
  20. Nannospalax galili miRNA (ENSNGAG00000002283.1)
  21. Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 485 (ENSNLEG00000023958.2)
  22. Otolemur garnettii (small-eared galago) microRNA 485 (ENSOGAG00000017267.1)
  23. Pan paniscus (bonobo) microRNA 485 (ENSPPAG00000007471.1)
  24. Pan troglodytes ptr-mir-485 (ENSPTRG00000027560.3)
  25. Papio anubis (Olive baboon) mir-485 microRNA precursor family
  26. Pongo abelii mir-485 microRNA precursor family
  27. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-485 precursor
  28. Propithecus coquereli (Coquerel's sifaka) microRNA 485 (ENSPCOG00000008092.1)
  29. Rhinopithecus bieti microRNA 485 (ENSRBIG00000008076.1)
  30. Rhinopithecus roxellana microRNA 485 (ENSRROG00000002630.1)
  31. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) microRNA 485 (ENSSBOG00000019041.1)
  32. Vicugna pacos (alpaca) miRNA (ENSVPAG00000016571.1)
2D structure Publications