Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-4647 precursor URS000075D03E_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR4647: MIR4647 is a non-coding RNA that is located within the 3'-UTR of the SLC35B2 gene [PMC9296583]. It is one of the eight upregulated miRNA sequences found in non-protein coding genes [PMC5823624]. The effects of MIR4647 on cell migration and colony forming were analyzed by optimizing the transfection process of corresponding miRNA precursors [PMC9843305]. The perturbation of MIR4647 by a miRNA inhibitor did not suppress the cytopathic effects of HSV-1 infection [PMC9296583]. The genomic locus of MIR4647 overlaps with the 3'-UTR of SLC35B2, suggesting that sgRNAs targeting MIR4647 may reduce the expression of SLC35B2 [PMC9296583]. In a screen, MIR4647 was identified as a candidate miRNA, along with three candidate genes (IRF2BPL, PAPSS1, and VANGL2) [PMC9296583]. Overall, MIR4647 is an intragenic miRNA residing within an upregulated gene and its role in cell migration and colony forming has been investigated [PMC5823624] [PMC9843305] [PMC9296583]. References: - PMC5823624 - PMC9843305 - PMC5069896 - PMC9296583

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCAGGAGGGUGAAGAUGGUGCUGUGCUGAGGAAAGGGGAUGCAGAGCCCUGCCCAGCACCACCACCUCCUAUGCUCCUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications