Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-4454 precursor URS000075D025_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR4454: MIR4454 is a microRNA that has been found to be overexpressed in ameloblastomas, a type of tumor, in several studies [PMC7920560] [PMC5354851]. Artificial induction of MIR4454 expression has been shown to reduce tumor tissue and increase sensitivity to certain drugs, such as 5FU, CPT11, and oxaliplatin [PMC7602903]. The drug transporter MRP5 has been found to decrease sensitivity to oxaliplatin by increasing drug efflux and reducing intracellular oxaliplatin accumulation [PMC7602903]. Downregulation of MIR4454 has been associated with drug resistance in colorectal cancer [PMC7602903]. Additionally, it has been observed that some reads of hsa-miR-4454 display heterogenous 5' ends that differ from the annotated genomic locus sequence but match the sequence of tRNAHis [PMC6675128]. The expression profile of three miRNAs related to hepatocellular carcinoma (HCC), including MIR4454, was assessed using RT-qPCR at different time points in order to determine the effect of different combinations of reference genes on normalization [PMC7035418]. Overall, these studies highlight the potential role and significance of MIR4454 in tumor development and drug response.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCGGAUCCGAGUCACGGCACCAAAUUUCAUGCGUGUCCGUGUGAAGAGACCACCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications