Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-324 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-324 precursor URS000075CFD7_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR324: MIR324 is a microRNA that has been associated with adrenergic trans-differentiation of sensory nerves in mouse models of oral cancer [PMC7396546]. The regulatory regions of murine MIR324 have been found to contain a TonE consensus sequence, suggesting that TonEBP may regulate the expression of this microRNA [PMC9104010]. The removal of MIR324 in mice has been shown to result in hippocampal hyperexcitability and an increase in epilepsy-associated events [PMC8129095]. Additionally, the removal of MIR324 has been found to significantly alter the expression of genes in the hippocampus and neocortex [PMC8129095]. Mice lacking MIR324 have also been found to exhibit an increase in hyperexcitable epilepsy-related events [PMC8129095]. The expression levels of MIR324 have been shown to be altered with age and sex, with many key miRNAs, including miR-34a, being upregulated in the ageing brain and showing differential expression by sex [PMC8129095]. Furthermore, high expression levels of MIR324 have been associated with better prognosis in breast cancer patients [PMC8648947]. It has also been suggested that further investigation into the downstream effects of MIR324 removal may reveal novel pathways involved in certain conditions such as ISOD and PPDE [PMC8129095]. Overall, understanding the role and regulation of MIR324 may provide insights into various biological processes and potential therapeutic targets.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUGACUAUGCCUCCCCGCAUCCCCUAGGGCAUUGGUGUAAAGCUGGAGACCCACUGCCCCAGGUGCUGCUGGGGGUUGUAGUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 38 other species

  1. Aotus nancymaae (Ma's night monkey) microRNA 324 (ENSANAG00000011504.1)
  2. Balaenoptera musculus microRNA 324 (ENSBMSG00010021754.1)
  3. Camelus dromedarius (Arabian camel) microRNA 324 (ENSCDRG00005020613.1)
  4. Camelus ferus mir-324 microRNA precursor family
  5. Castor canadensis (American beaver) miRNA (ENSCCNG00000016524.1)
  6. Cebus imitator (Panamanian white-faced capuchin) microRNA 324 (ENSCCAG00000019556.1)
  7. Cercocebus atys microRNA 324 (ENSCATG00000019606.1)
  8. Chlorocebus sabaeus (African green monkey) microRNA 324 (ENSCSAG00000023887.1)
  9. Colobus angolensis palliatus miRNA (ENSCANG00000003721.1)
  10. Dasypus novemcinctus (nine-banded armadillo) microRNA 324 (ENSDNOG00000028509.1)
  11. Delphinapterus leucas microRNA 324 (ENSDLEG00000020837.1)
  12. Equus asinus asinus microRNA 324 (ENSEASG00005018656.1)
  13. Equus asinus (ass) microRNA 324 (ENSEASG00005018656.2)
  14. Equus caballus microRNA eca-mir-324 precursor
  15. Gorilla gorilla gorilla microRNA 324 (ENSGGOG00000030676.2)
  16. Gorilla gorilla mir-324 microRNA precursor family
  17. Macaca fascicularis microRNA 324 (ENSMFAG00000005957.2)
  18. Macaca mulatta microRNA mml-mir-324 precursor
  19. Macaca nemestrina (Pig-tailed macaque) microRNA 324 (ENSMNEG00000024341.1)
  20. Mandrillus leucophaeus (Drill) microRNA 324 (ENSMLEG00000009004.1)
  21. Monodon monoceros (narwhal) microRNA 324 (ENSMMNG00015019224.1)
  22. Myotis brandtii mir-324 microRNA precursor family
  23. Myotis lucifugus microRNA 324 (ENSMLUG00000018029.1)
  24. Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 324 (ENSNLEG00000022251.2)
  25. Otolemur garnettii microRNA 324 (ENSOGAG00000017382.1)
  26. Pan paniscus (bonobo) microRNA 324 (ENSPPAG00000014140.1)
  27. Pan troglodytes ptr-mir-324 (ENSPTRG00000027615.3)
  28. Papio anubis microRNA 324 (ENSPANG00000003205.3)
  29. Phocoena sinus microRNA 324 (ENSPSNG00000016181.1)
  30. Physeter catodon (sperm whale) microRNA 324 (ENSPCTG00005014831.1)
  31. Piliocolobus tephrosceles (Ugandan red Colobus) microRNA 324 (ENSPTEG00000016385.1)
  32. Pongo abelii mir-324 microRNA precursor family
  33. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-324 precursor
  34. Rhinolophus ferrumequinum (greater horseshoe bat) microRNA 324 (ENSRFEG00010011709.1)
  35. Rhinopithecus bieti microRNA 324 (ENSRBIG00000019512.1)
  36. Rhinopithecus roxellana microRNA 324 (ENSRROG00000028007.1)
  37. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) microRNA 324 (ENSSBOG00000016945.1)
  38. Theropithecus gelada (gelada) microRNA 324 (ENSTGEG00000023095.1)
  39. Tursiops truncatus (bottlenosed dolphin) microRNA 324 (ENSTTRG00000023840.1)
2D structure Publications