Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-4460 precursor URS000075CF7B_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-4460: The study identified hsa-mir-4460 as one of the top predicted target miRNAs of hsa-circRNA_005019 [PMC5544722]. This study was the first to investigate exosomal miRNA profiles in subcutaneous adipose tissue (SAT) obtained from patients with obesity and lean patients, and it identified 10 differentially expressed (DE) miRNAs, including hsa-mir-4460, which was upregulated [PMC6102639]. Overexpression of hsa-mir-4460 was predicted to inhibit the expression of MED13, which was downregulated in SAT obtained from patients with obesity [PMC6102639]. The downregulated hsa-miR-3156-5p and upregulated hsa-mir-4460 were found to be important exosomal miRNAs in SAT, regulating CD86 and MED13, respectively [PMC6102639]. In addition, other miRNAs such as hsa-miR-582-5p, hsa-miR-566, and miR-548 were found to be important in visceral adipose tissue (VAT) via regulation of FGF2, FOSL2, and AMPD3 respectively [PMC6102639]. The study identified 10 DE-miRNAs in SATs between patients with obesity and lean patients using specific threshold values [PMC6102639]. Hsa-mir-4460 was the only upregulated miRNA found in the exosomes of SAT from patients with obesity compared to lean patients [PMC6102639]. The downregulation of MED13 by hsa-mir-4460 may contribute to the development of obesity by suppressing metabolism [PMC6102639].\

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUUUUUUGCCCAUAGUGGUUGUGAAUUUACCUUCUCCUCUUUGCAGUGAUAAAGGAGGUAAAUUCACAACCACUGUGGGCAGAAAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

Publications