v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) DLG3 antisense RNA 1 (DLG3-AS1) URS000075CF73_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

DLG3-AS1: DLG3-AS1 is an antisense gene that has been identified as a hub gene in several studies [PMC8818217] [PMC9683342]. However, there is no available data on the expression of DLG3-AS1 in the Human Protein Atlas [PMC8818217]. DLG3-AS1, along with other lncRNAs such as C10orf91, LINC00303, and ARHGEF38-IT1, has been identified as a hub gene in the MEturquoise module [PMC8818217]. Additionally, DLG3-AS1 has been suggested as a potential hub gene for Parkinson's disease (PD) patients [PMC9683342]. GSEA analysis revealed that DLG3-AS1 is mainly involved in various biological processes such as glycosaminoglycan biosynthesis, histidine metabolism, and nicotine addiction [PMC9683342]. However, there are no specific studies reporting the role of DLG3-AS1 in PD or other diseases [PMC9683342]. In PD patients, the expression of DLG3-AS1 was found to be downregulated compared to healthy samples [PMC9683342]. Overall, DLG3-AS1 has been identified as a hub gene and its biological functions are still being investigated.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CACAGGGCCUAGGUGUCCCAGGAGCCCAGGCGCUGCAGCCCUAGGGGACAAAGGGGAGGAGGAGGCGAAAGAAGUCGGGAAUGAUUCUCCUAUCCUACCAACCCGUGUGAUGGACCCUGGACCACAAGAAGAGGAAGCAGUUAGGGGCAGUGGAGUCACCCUGGGGUUGACUGCACUCAUCAUCCACAGGAUGUGCACACUUACUUCACAGACACUCUUCUGCAGUCUCAAAAUCUCACCCAUCAACUAUGACCCCUCCUACCUGCUGCCCCAACAACAUAUUUAAUCAGCAGCUAACACUAUGUAGCCCCAGGGGGUUGCAGCGCCUGGGUUCUUAGGGGGAUCCCAGGUCCCCAAAAGGAGUUUAGAAUCCAAACUGAAGAGAGCAGACAAGCACAUGAGAAAUGCGAAUAAAACUAACCACAUCUAAGGAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications