Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-650 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-650 precursor URS000075CEFF_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR650: MIR650 is a miRNA gene located on chromosome 22q11.22. It has been found to be significantly deleted in various cancers, including chronic lymphocytic leukemia (CLL) and colorectal cancer (CRC) [PMC3938728] [PMC4897824]. MIR650 is known to be directly regulated by Tumor Necrosis Factor (TNF), a group of cytokines that can induce apoptosis [PMC3938728]. It has been shown that MIR650 plays a role in the transcriptional regulation of MGMT, a gene involved in DNA repair and resistance to chemotherapy [PMC8010678]. Additionally, MIR650 has been implicated in the regulation of various other genes and pathways involved in cancer progression, including ING4, CDK1, and EBF3 [PMC3938728]. The dysregulation of MIR650 has been associated with tumor invasion and metastasis in renal carcinomas [PMC3726994]. Furthermore, studies have shown that the expression of MIR650 is negatively correlated with the mature state of dendritic cells during influenza A virus infection [PMC8779696]. Overall, MIR650 is an important miRNA gene involved in various biological processes and its dysregulation has been implicated in multiple cancers.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAGUGCUGGGGUCUCAGGAGGCAGCGCUCUCAGGACGUCACCACCAUGGCCUGGGCUCUGCUCCUCCUCACCCUCCUCACUCAGGGCACAGGUGAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Gorilla gorilla gorilla microRNA 650 (ENSGGOG00000040787.1)
2D structure Publications