Cercocebus atys (Sooty mangabey) microRNA 3200 (ENSCATG00000020238.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Cercocebus atys (Sooty mangabey) microRNA 3200 (ENSCATG00000020238.1) URS000075CE96_9531

85 nucleotides
1 database (Ensembl)
Found in 10 other species
2 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

GGUGGUCGAGGGAAUCUGAGAAGGCGCACAAGGUUUGUGUCCAAUACAGUCCACACCUUGCGCUACUCAGGUCUGCUCGUGCCCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

Colobus angolensis palliatus miRNA (ENSCANG00000019549.1)
Gorilla gorilla gorilla microRNA 3200 (ENSGGOG00000043079.1)
Homo sapiens microRNA hsa-mir-3200 precursor
Macaca nemestrina (Pig-tailed macaque) microRNA 3200 (ENSMNEG00000011047.1)
Mandrillus leucophaeus (Drill) microRNA 3200 (ENSMLEG00000022576.1)
Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 3200 (ENSNLEG00000025762.2)
Pan paniscus (bonobo) microRNA 3200 (ENSPPAG00000008990.1)
Pan troglodytes microRNA mir-3200 (ENSPTRG00000039195.2)
Pongo abelii miRNA
Rhinopithecus bieti microRNA 3200 (ENSRBIG00000017763.1)

2D structure

Publications