v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 3200 (ENSNLEG00000025762.2) secondary structure diagram

Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 3200 (ENSNLEG00000025762.2) URS000075CE96_61853

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GGUGGUCGAGGGAAUCUGAGAAGGCGCACAAGGUUUGUGUCCAAUACAGUCCACACCUUGCGCUACUCAGGUCUGCUCGUGCCCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Cercocebus atys microRNA 3200 (ENSCATG00000020238.1)
  2. Colobus angolensis palliatus miRNA (ENSCANG00000019549.1)
  3. Gorilla gorilla gorilla microRNA 3200 (ENSGGOG00000043079.1)
  4. Homo sapiens microRNA hsa-mir-3200 precursor
  5. Macaca nemestrina (Pig-tailed macaque) microRNA 3200 (ENSMNEG00000011047.1)
  6. Mandrillus leucophaeus (Drill) microRNA 3200 (ENSMLEG00000022576.1)
  7. Pan paniscus (bonobo) microRNA 3200 (ENSPPAG00000008990.1)
  8. Pan troglodytes microRNA mir-3200 (ENSPTRG00000039195.2)
  9. Pongo abelii miRNA
  10. Rhinopithecus bieti microRNA 3200 (ENSRBIG00000017763.1)
 2D structure Publications