Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-3200 precursor URS000075CE96_9606

  • 85 nucleotides
  • 8 databases (ENA, Ensembl, Ensembl/GENCODE, GeneCards, HGNC, MalaCards, miRBase, RefSeq)
  • Found in 11 species

Automated summary: This pre miRNA sequence is 85 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (Ensembl/GENCODE, RefSeq, Ensembl, MalaCards, ENA, GeneCards, HGNC, miRBase). Described in 14 papers. Matches 1 Rfam family (mir-3200, RF03405). Homo sapiens (human) microRNA hsa-mir-3200 precursor sequence is a product of MIR3200, hsa-mir-3200 precursor, mir-3200 precurso, mir-3200, mir-3200 precursor genes. Found in the human reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GGUGGUCGAGGGAAUCUGAGAAGGCGCACAAGGUUUGUGUCCAAUACAGUCCACACCUUGCGCUACUCAGGUCUGCUCGUGCCCU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 10 other species

    1. Cercocebus atys (Sooty mangabey) miRNA
    2. Colobus angolensis palliatus microRNA 3200
    3. Gorilla gorilla gorilla (Western Lowland Gorilla) microRNA 3200
    4. Macaca fascicularis (Crab-eating macaque) miRNA
    5. Macaca nemestrina miRNA
    6. Mandrillus leucophaeus (Drill) miRNA
    7. Nomascus leucogenys (Northern white-cheeked gibbon) miRNA
    8. Pan paniscus (bonobo) miRNA
    9. Pan troglodytes (chimpanzee) microRNA mir-3200 (MIR3200)
    10. Papio anubis (Olive baboon) miRNA
    11. Pongo abelii miRNA
    12. Rhinopithecus bieti miRNA