v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) MIR503 host gene (MIR503HG) URS000075CE3A_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR503HG: MIR503HG is an upregulated intergenic long non-coding RNA (lncRNA) in endothelial cells during hypoxia [PMC6114261]. Overexpression of MIR503HG leads to increased levels of apoptosis-related proteins Bax and cleaved caspase-3, and decreased levels of Bcl-2 [PMC8027537]. MIR503HG has been shown to regulate ALK-positive cell proliferation in tumor specimens from mice [PMC5983830]. It can also promote methylation of miR-31-5p, acting as a sponge to inhibit migration and invasion of ovarian cancer cells [PMC9320548]. MIR503HG suppresses the promotion effect of SPI1 on the luciferase activities of the WT-TMEFF1 reporter, but not on the MUT-TMEFF1 reporter [PMC9320548]. In triple-negative breast cancer (TNBC), MIR503HG regulates HOXA9 through miR-224-5p and low expression is associated with poor prognosis [PMC9664671] [PMC6584514]. It is a downstream effector of cisplatin in cisplatin-resistant cervical cancer cells [PMC7060770]. MIR503HG regulates invasion and migration of trophoblast cells through the NF-κB pathway [PMC9024043] and also affects IκBα phosphorylation and nuclear NF-κB p65 translocation in HTR-8/SVneo cells [PMC6701315]. In non-small cell lung cancer, downregulation of MIR503HG enhances tumor cell metastasis through activation of NF‐κB/NLRP3 inflammasome pathway [PMC10040667]. It suppresses hepatocellular carcinoma cell invasion and metastasis through modulating HNRNPA2B1/NF‐κB pathway as well as cyclin D1 expression [PMC6584514] [PMC5957011]. MIR503HG expression is analyzed in NSCLC and is involved in NETs-induced migratory capacity [PMC7062398] [PMC9190762].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GAAGGUAGAAGGUGGGGUCUGCCGGACGCGUGUUCCUGCCACCAGGUGCCCGCUCCCCGCGAGGCCGGCUCAGGAGCAGAAGGAAGCCCGGUGCCAGCCAGCCUUCCUGAAAGACCAAGCCCGCGCCAUCCGGCUUCCUCCAGUGGACGCCUGCAGGACCCAGGAAUGUUUUUCUUGAAGGCAUCCAGCAUCUCCAGUUAGCAGUACUGAUUUUUUUUCCCCCCAACAAAGGAACACUACAUCAACACUGUUGGCGGGGACCUGGACACAGAAGACUCCUGUUUCAAGAAAAUACAAUCAUCUCUCAAAGGCUGUAAUUUAUAUGCAUUUUAAAACUCUAGGCAUUGAAAACCACCCAAGUGUCCCAAAUAGAAGGGUAAUAUAUAAUCAAUCACUCAGUGUAAUAUUAUACAUCCUUUAAAAAUGUUAUUGGGAAAUGUUUUAUGAUCUGUAAGUCCAAGGAAUCCUCUCCCACCAUUUCUUUCCCCCCGCUGUUCCCCCAUACCCACACUUCUUUGUUCCAAUUGGCAUGUAAAUUUGGUUUUCCCGCCAAAUGAGUCAGUCAUGAUGGGAACCUCAACUGAUUUGAACAGAUGUGUGUCAAUGUUACUUGGAAAACUAGAUGUCAAUAACCAGGGUCACAGAAAAAGGCAGUGGUCACAACUCUGUAAAAAUGUAUGCAUGCACACAGACAAGAACUAAAGUGGAACCCCACACAGGAAAACAGUGGGCUGUACUCCAGUGCUGGGACAUUGAAUGACUGUAUGCUGCUUUUGAUUUCCGUUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications