v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) non-protein coding LINC01116:6 URS000075CE23_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC01116: LINC01116 is a long non-coding RNA (lncRNA) that has been implicated in various diseases, including endometriosis [PMC7882988], glioma [PMC7986001] [PMC7195423], non-small cell lung cancer (NSCLC) [PMC8876905], prostate cancer [PMC7519870], breast cancer [PMC7982720], osteosarcoma [PMC7519870], bladder cancer [PMC7733594], and colorectal cancer (CRC) [PMC7573327]. In endometriosis, the function and mechanism of LINC01116 were investigated in vitro [PMC7882988]. In glioma, LINC01116 expression and prognostic value were assessed using the GEPIA website and it was found that LINC01116 could recruit DDX5 to the IL-1β promoter region to activate transcription in glioma cells [PMC7986001] [PMC7195423]. LINC01116 was found to modulate gefitinib resistance in NSCLC cells by regulating interferon-induced protein (IFI)44 expression [PMC8876905]. In prostate cancer cells and breast cancer tissues, LINC01116 was upregulated and its knockdown resulted in decreased cell proliferation [PMC7519870] [PMC7982720]. In osteosarcoma cells, LINC0116 promoted cell viability and migration [PMC7519870]. Additionally, it was found that LINC01116 could bind to EZH2 to regulate the expression of PTEN and p53 [PMC7982720]. In bladder cancer cells, the subcellular location of LINC01116 was investigated [PMC7733594]. Furthermore, LINC0116 was associated with gefitinib resistance in lung adenocarcinoma (LUAD) [PMC8876905]. Overall, LINC01116 has been shown to play an oncogenic role in multiple human cancers and has potential as a diagnostic and prognostic biomarker in various diseases [PMC7573327] [PMC7860012].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CAGGAAAUGACCCGAACUGCCAGCCUGCGCCUUUGCAGCCGGCCCUCGCUUUGCUGAAGACGAGCAGCUCCCACCAAAGUCUUGCCUCCCCUUACCCCGAAAGCCCCGCUCAGUUCAAUAUUUCAAGUGAAAAUCUGCCUGUUCGAAAAGAAAAUAUUCACAAAUGAGCAGUGUAUUAGAAGACAACUGAAUUGCUUCUAAGAAUGGGUCUCACUCUGCCAUCACCCAGGCUGGAGUGUGGUGGCACCAUCAUGGCUCACUGCAGCCUUGAACUCCUGAGCUCAAGUCAUCCUCCCACCUCAGCCUUCCGAGUAGCUGGAACUGCAGGUGUGAGCCACCAUGCCUGGCUGAUUUGUCUUUUUAAAUUUUUUAUAGAGACCGAGUCUCAACUAUAUUGUCCAGGCUGGAAAAGAACUUCUUUCCCUCCAAGUGAUAACCUUUUCCAGACAAGUCAGCUUAAAAACUGACCCAAAGGCCCUGAAGUACACAGUUUUCUUGGAGAAAGAAAAAAAUAAGUGAAAAGGACUUGCUGACUUGCUAAUUCAUUUUGGGGCCUGUGGGUAACAUCAGAAUGGCAAAGCACUUGGGGCUUUUUUCUAAUUUGUAUUUUUUUAAUCUUCUGAGAAAUGACUUUUAUAUGCCAAGAUUCAUUCCAUGAUUAGUUUUUAUGACCAAGUUAUGAACGCUUUUGAAUAUGGGGACCUAGAAUAGAAAUGCUAACCUACCUGCAAGGAGAGCUCUGUGAUUGGCAUCCCCAUCAUGCUGUAACUGACACAAAAUAAACUUAGGGUAAUUGCCGCAUAGUGUAACUUUAAUGUGUGAGCAUACUGUAACAUCUGACAAGCUUCUUGAUCUAGAUCAGCAAUGUGUAACCCAUUCAUUGUUGUCACUCUCAACAAGGCCUUAUGGUCAAACAUCAUCACUCUCACUAAAGAGAUAGUUUACUGAAAUAUACUGAGAUUUUGAAACUGGAGUCAAGAGGUAGCACACUGUUUUAUGUUGAUCCAUUUAAUGGUCCUUGACAGCCAAUAAAAAGACACUGGAAGAAUACGUGAAUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications