v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-143 URS000075CDFC_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-143: Bta-mir-143, a bovine miRNA, is considered a weaker case of an exogenous miRNA based on sequence and expression evidence [PMC5952930]. It has been observed that bta-mir-143 is significantly upregulated in the corpus luteum (CL) compared to the early corpus luteum (eCL) [PMC5736867]. In the CL, bta-mir-143 is the second most abundantly expressed miRNA and is believed to play a role in the regression of the CL [PMC5736867]. Experimental validation has shown that has-miR-143, a homologous miRNA, targets COL1A1, and it is predicted that bta-mir-143 also targets COL1A1 [PMC5736867].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGAGAUGAAGCACUGUAGCUCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

  1. Artibeus jamaicensis aja-miR-143
  2. Capra hircus (goat) chi-miR-143-3p
  3. Gallus gallus gga-miR-143-3p
  4. Monodelphis domestica mdo-miR-143-3p
  5. Mus musculus Mus_musculus piRNA piR-mmu-49040582
  6. Tupaia chinensis tch-miR-143-3p
  7. Xenopus tropicalis xtr-miR-143
 Publications