Automated summary: This pre miRNA sequence is 82 nucleotides long and is found in Moschus moschiferus. Annotated by 1 database (Ensembl). Has a conserved secondary structure or a structured region. Moschus moschiferus (Siberian musk deer) miRNA (ENSMMSG00000010816.1) sequence is a product of ENSMMSG00000010816.1 gene. Found in the Moschus moschiferus reference genome.
This sequence is found in {{ locations.length }} genome
| Go to location | Chromosome | Start | End | Strand | Ensembl | UCSC | Sequence identity | |
|---|---|---|---|---|---|---|---|---|
| Loading genome locations... | ||||||||
| Failed to load data from server | ||||||||
| No genome locations known | ||||||||
|
loading browser
|
{{ location.chromosome }} | {{ location.start | number }} | {{ location.end | number }} | {{ location.strand == "1" ? "forward" : "reverse" }} | {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} | UCSC | 100% | {{ location.identity * 100 | number:0 }}% |
No genome locations found for this sequence. Learn more →
Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset
GGCCUGCCUGACACUCUUUCCCUGUUGCACUACUGUGCGCCCCUGGCAAGCAGUGCAAUGAUGAAAGGGCAUCGGUCAGGCC
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.