Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-646 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-646 precursor URS000075CDB8_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR646: MIR646 is a microRNA that has been shown to regulate FGF2 and is also associated with colorectal cancer [PMC4823089]. It has been reported that MIR646 can bind to hsa_circ_0081143 and effectively reverse the inhibition of CDK6, which is related to lymph node metastasis and poor prognosis in gastric carcinoma patients [PMC8335809]. In a study evaluating the prognostic values of different genes, higher expression of MIR646 was associated with better overall survival in patients [PMC9113459]. In pancreatic ductal adenocarcinoma (PDAC), MIR646 is one of the amplified genes that are involved in cell proliferation, tumor growth, metastasis, apoptosis, migration, invasiveness, and epithelial-mesenchymal transition (EMT) [PMC9599555]. Additionally, MIR646 expression was found to be upregulated in a study on patients with systemic-onset juvenile idiopathic arthritis (SoJIA) [PMC9324496]. Overall, MIR646 plays a role in various biological processes and has been implicated in different diseases.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GAUCAGGAGUCUGCCAGUGGAGUCAGCACACCUGCUUUUCACCUGUGAUCCCAGGAGAGGAAGCAGCUGCCUCUGAGGCCUCAGGCUCAGUGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

2D structure Publications