Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Gallus gallus (chicken) microRNA gga-mir-137 precursor secondary structure diagram

Gallus gallus (chicken) microRNA gga-mir-137 precursor URS000075CDA5_9031

Automated summary: This pre miRNA sequence is 96 nucleotides long and is found in Gallus gallus. Annotated by 4 databases (Ensembl, miRBase, RefSeq, ENA). Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-137, RF00694). Gallus gallus (chicken) microRNA gga-mir-137 precursor sequence is a product of mir-137 precursor, MIR137, ENSGALG00000018336.2, gga-mir-137 precursor, mir-137, mir-137 precurso genes. Found in the chicken reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UCUGACUCUCUUCGGUGACGGGUAUUCUUGGGUGGAUAAUACGGAUUACGUUGUUAUUGCUUAAGAAUACGCGUAGUCGAGGAGAGUACCGGCGGC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 43 other species

    1. Accipiter nisus (Eurasian sparrowhawk) microRNA 137 (ENSANIG00000017876.1)
    2. Amazona collaria microRNA 137 (ENSACOG00000005624.1)
    3. Anas platyrhynchos microRNA 137 (ENSAPLG00020015532.1)
    4. Anas platyrhynchos platyrhynchos microRNA 137 (ENSAPLG00000000001.2)
    5. Anas zonorhyncha miRNA (ENSAZOG00000001705.1)
    6. Anser brachyrhynchus microRNA 137 (ENSABRG00000014901.1)
    7. Anser cygnoides microRNA 137 (ENSACDG00005004972.1)
    8. Aquila chrysaetos chrysaetos microRNA 137 (ENSACCG00020009887.1)
    9. Bubo bubo (Eurasian eagle-owl) miRNA (ENSBOBG00000004907.1)
    10. Buteo japonicus (eastern buzzard) miRNA (ENSBJAG00000008691.1)
    11. Cairina moschata domestica (muscovy Duck (domestic type)) miRNA (ENSCMMG00000017060.1)
    12. Calidris pugnax (ruff) microRNA 137 (ENSCPUG00000003851.1)
    13. Calidris pygmaea (Spoon-billed sandpiper) microRNA 137 (ENSCPGG00000001980.1)
    14. Camarhynchus parvulus microRNA 137 (ENSCPVG00000011416.1)
    15. Catharus ustulatus miRNA (ENSCUSG00005002088.1)
    16. Chrysolophus pictus microRNA 137 (ENSCPIG00010007964.1)
    17. Corvus moneduloides miRNA (ENSCMUG00000005351.1)
    18. Coturnix japonica microRNA 137 (ENSCJPG00005000322.1)
    19. Cyanistes caeruleus microRNA 137 (ENSCCEG00000001115.1)
    20. Cyanoderma ruficeps microRNA 137 (ENSCRFG00000010903.1)
    21. Chloebia gouldiae microRNA 137 (ENSEGOG00005004166.1)
    22. Falco tinnunculus miRNA (ENSFTIG00000010319.1)
    23. Ficedula albicollis microRNA 137 (ENSFALG00000016050.2)
    24. Geospiza fortis (medium ground-finch) microRNA 137 (ENSGFOG00000007777.1)
    25. Junco hyemalis microRNA 137 (ENSJHYG00000016970.1)
    26. Lepidothrix coronata (blue-crowned manakin) microRNA 137 (ENSLCOG00000002150.1)
    27. Lonchura striata domestica microRNA 137 (ENSLSDG00000010866.1)
    28. Malurus cyaneus samueli miRNA (ENSMCSG00000004092.1)
    29. Manacus vitellinus microRNA 137 (ENSMVIG00005009662.1)
    30. Meleagris gallopavo microRNA 137 (ENSMGAG00000019605.1)
    31. Melopsittacus undulatus (Budgie) microRNA 137 (ENSMUNG00000014425.1)
    32. Nothoprocta perdicaria microRNA 137 (ENSNPEG00000004914.1)
    33. Numida meleagris microRNA 137 (ENSNMEG00000018140.1)
    34. Otus sunia miRNA (ENSOSUG00000015341.1)
    35. Parus major microRNA 137 (ENSPMJG00000019346.1)
    36. Pavo cristatus (Indian peafowl) microRNA 137 (ENSPSTG00000008557.1)
    37. Phasianus colchicus (Ring-necked pheasant) microRNA 137 (ENSPCLG00000022325.1)
    38. Serinus canaria (common canary) microRNA 137 (ENSSCAG00000012463.1)
    39. Strigops habroptila (Kakapo) microRNA 137 (ENSSHBG00005011869.1)
    40. Strix occidentalis caurina (northern spotted owl) miRNA (ENSSOCG00000013416.1)
    41. Taeniopygia guttata (zebra finch) microRNA 137 (ENSTGUG00000017948.2)
    42. Zonotrichia albicollis microRNA 137 (ENSZALG00000007347.1)
    43. Zosterops lateralis melanops (silver-eye) microRNA 137 (ENSZLMG00000010101.1)
    2D structure Publications New