Automated summary: This pre miRNA sequence is 96 nucleotides long and is found in Gallus gallus. Annotated by 4 databases (ENA, RefSeq, miRBase, Ensembl). Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-137, RF00694). Gallus gallus (chicken) microRNA gga-mir-137 precursor sequence is a product of MIR137, gga-mir-137 precursor, mir-137, ENSGALG00010024487.1, mir-137 precursor, mir-137 precurso genes. Found in the Gallus gallus reference genome.
This sequence is found in {{ locations.length }} genome
| Go to location | Chromosome | Start | End | Strand | Ensembl | UCSC | Sequence identity | |
|---|---|---|---|---|---|---|---|---|
| Loading genome locations... | ||||||||
| Failed to load data from server | ||||||||
| No genome locations known | ||||||||
|
loading browser
|
{{ location.chromosome }} | {{ location.start | number }} | {{ location.end | number }} | {{ location.strand == "1" ? "forward" : "reverse" }} | {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} | UCSC | 100% | {{ location.identity * 100 | number:0 }}% |
No genome locations found for this sequence. Learn more →
Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset
UCUGACUCUCUUCGGUGACGGGUAUUCUUGGGUGGAUAAUACGGAUUACGUUGUUAUUGCUUAAGAAUACGCGUAGUCGAGGAGAGUACCGGCGGC
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.