Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-665 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-665 precursor URS000075CD82_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR665: MIR665 is a microRNA that has been implicated in various biological processes and diseases. It is a downstream miRNA with high affinity to circ_0087207 and is inhibited by circ_0087207 to regulate DNA damage/repair and apoptosis [PMC9027941]. MIR665 has been shown to target genes involved in growth retardation and postnatal lethality, such as Col5a1, Clip2, and Pcgf2 [PMC5886287]. In colonic mucosal tissues, MIR665 has been found to target Xbp1 and promote apoptosis and colitis [PMC6031203]. It has also been shown to inhibit cell growth in various cancer types, including prostate cancer and gastrointestinal stromal tumors [PMC6438025]. Furthermore, MIR665 has been identified as a suppressor of E2F3 mRNA by binding to its 3'-UTR region [PMC9701882]. In breast cancer, MIR665 is upregulated by COX-2 overexpression along with miR526b [PMC5762661]. Overall, MIR665 plays a significant role in regulating gene expression involved in DNA damage/repair, apoptosis, growth retardation, postnatal lethality, colitis promotion, and oncogenesis.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCUCCUCGAGGGGUCUCUGCCUCUACCCAGGACUCUUUCAUGACCAGGAGGCUGAGGCCCCUCACAGGCGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

2D structure Publications