v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) MYC-induced long non-coding RNA (MINCR) URS000075CD64_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MINCR: MINCR (MYC-induced long non-coding RNA) is a long non-coding RNA that has been found to be significantly correlated with MYC expression in MYC-positive lymphomas [PMC7579998]. It has also been identified to be highly increased in non-small cell lung cancer (NSCLC) tissues and cell lines [PMC6724276]. Higher expression levels of MINCR have been associated with lower overall survival rates and progression-free survival in patients with NSCLC [PMC9893525]. Additionally, MINCR knockdown has been shown to affect the expression of cell-cycle related genes, such as AURKA, AURKB, and CDT1, leading to the perturbation of cell-cycle progression [PMC6165225]. These findings suggest that MINCR may play a role in the development and progression of NSCLC. Further research is needed to fully understand the mechanisms by which MINCR influences tumor growth and survival.

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CGGUUUUUUCCUCAGGCUUCCGGUCUGUUUGGUGCCCUGGUCGCGUGUCUUCCGAACUCUGCUGCUUCGCCCCGGCAAGAGCACUUCCUUCCGCGGCUGCUAAAACUGGUGCGCGGGUUCCCAACUUCGCAGAAGAGCUUCAUCGGCCCCCCGCUAGAGACCUCAGACCGCAGCCAUCGACGCCUCGCCUCGGGGAUCUGUCCCCACCCUCGGGGCCAGCUCACCAUGAGUCAGGCCCUGUGCUAGGUGCUGGGAUGAAGCAGUGACUGACACAGGCCUGGACCUGUCCUUGGGAAGAGUGCGUCUGUGACACAGAUACUGUGCCAUGUGGCAAAACUUGAAUGGAGACAUCAGCUCUUUGUGGGUCUCAAGUCUACUGGCUUUCAAUCAGCUCUUCUGCUUGACAGCUGCAGGUCUUGGGACUGCCCAGCCCCCAUAACCCUGUGAGUGCAUUCCUGAUAAUAACCCUCUUUCUCUUGUCCUCCCCCACCCCACAUCAUUGGUUCUGUUUCUCUGGAGAACCAUAAUACAUCAUUUACUAAUCAGGAAAUAGAUUCAGAGACAUUAAUAACUCAUCCAACCUCACAGUUAACUGUAGAGUUGGGCUUGAAAUUCCAAGGUCGAUUUUCUUAGCCAAUACACCAUGCUACAUAUAUGUAUGUAAAAAUAAAAACGCUUGUGAACUGAAAAGGGUCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications