Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) microRNA bta-mir-2443 precursor URS000075CD24_9913

Automated summary: This pre miRNA sequence is 73 nucleotides long and is found in Bos taurus. Annotated by 4 databases (miRBase, ENA, Ensembl, RefSeq). Bos taurus (cattle) microRNA bta-mir-2443 precursor sequence is a product of ENSBTAG00000045309.2, mir-2443, mir-2443 precursor, 2443, mir-2443 precurso, bta-mir-2443 precursor, MIR2443 genes. Found in the cattle reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    GUGAGGGUUGAGGGCAGGACCGUAUGAGGUGUCCAAGGAAGGCUCCACUCAGCCGGCCCUUCCCUCCCCUCAC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 4 other species

    Publications New