Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-3943 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-3943 precursor URS000075CCF9_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-3943: Hsa-mir-3943 is a microRNA that has been identified as a potential diagnostic biomarker associated with the progression of diabetic nephropathy (DN) [PMC9661593]. It is one of the eight core dysregulated DEmiRNAs that may improve the diagnosis of DN [PMC7940829]. Additionally, hsa-mir-3943 has been found to play a role in the diagnosis and treatment of schizophrenia [PMC7940829]. It is also one of the miRNAs targeted by hsa_circ_0089761 and hsa_circ_0089763, which share 26 identical miRNA targets [PMC9441041]. Furthermore, hsa-mir-3943 is among the 31 miRNAs identified with MiRWalk as being targeted by various other miRNAs [PMC6595612]. Overall, hsa-mir-3943 appears to be involved in multiple disease processes and may have diagnostic potential in DN, schizophrenia, and other conditions. However, further validation studies with larger sample sizes are needed to confirm its role as a diagnostic biomarker in these diseases.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CACACAGACGGCAGCUGCGGCCUAGCCCCCAGGCUUCACUUGGCGUGGACAACUUGCUAAGUAAAGUGGGGGGUGGGCCACGGCUGGCUCCUACCUGGAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Pan troglodytes miRNA
  2. Pongo abelii miRNA
2D structure Publications