Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) EGFR long non-coding downstream RNA (ELDR) URS000075CBD6_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ELDR: Cells have evolved the endolysosomal damage response (ELDR), a sophisticated defense mechanism that acts via multiple mechanisms in both the nucleus and cytoplasm [PMC6776906] [PMC9860170]. ELDR can interact with Ilf3 and induce cytoplasmic accumulation [PMC9860170]. ELDR has been implicated in various cellular processes, including cell growth, invasion, migration, and regulation of miRNAs [PMC8419183] [PMC8506548]. Genetic alterations of ELDR have been found to co-occur with alterations in other genes and induce the overexpression of onco-functional proteins [PMC9152008]. ELDR has been shown to have therapeutic potential for oral cancer [PMC8506548]. It has been found to interact with various miRNAs and exhibit tissue-specific expression patterns in different organs [PMC4409293]. ELDR has been shown to regulate the expression of FOXM1 and play a role in cell cycle progression, particularly in the G2/M phase [PMC9079251]. It is upregulated in oral cancer cells and may be involved in tumorigenic transformation [PMC9079251]. ELDR can stabilize CTCF, leading to upregulation of FOXM1-AURKA signaling pathway for G2/M progression [PMC9079251]. The specific interaction between ELDR and CTCF has been confirmed through immunoprecipitation assays [PMC9079251]

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AACAGAGGGCCGUUACACUCACAGUGUAAGAACAGACUGACAAUUCCAGGGCGCUGGCUUUUAUGAAAAUAGGAAACGCCACGAUGCACUCUAACGUGGAGAUGGGGCGCCGUUCACACUGAGAUGAGACAGGUGGAAAAGAGAGCUCGCCCUUCUUGCAUUGUCACACGGAGCGGCCCUCUCCCUGUGCAGCGUGGAGUCCCCUGGGCGCGGGCGAGGCUCAGGCGGGACGCGGCGGAGACCGAGCUUGUCCCUGUGUGGACCCGGGCAACUGCCGGUGGGCGAGGCCUGGAUGGUGGCCAGGCCGCAGCCACCCGGACGUUUGCGAGCGCCGAAGGUGUGUAAAAAUCGCUCCAGUGGUGAAUUGGAAACUCGCAGUGCCAGGAAGUGCUUCCACAGGCUUAAUGCAUCUCUGCUCCUCUUUUUUCAUAAAAAUUCAAAGUGUUUAGACGGGGGAUGCUGAGAGAGAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications