Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) HSALNT0203415 URS000075CA79_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ATXN8OS: ATXN8OS is a long non-coding RNA (lncRNA) that has been studied in various contexts [PMC6625414]. Knockdown of ATXN8OS has been found to suppress proliferation, increase the percentage of cells in the G0/G1 phase of the cell cycle, and decrease cell invasion in breast cancer cell lines [PMC6625414]. The translation of ATXN8OS ORF protein may be supported by the use of an alternative translation initiation site, specifically the second most common alternative initiation site GUG [PMC3770663]. ATXN8OS has been shown to sponge a tumor-suppressive miRNA called miR-424-5p, leading to the activation of oncogenes such as EYA1, DACH1, and CHRM3. This activation can be suppressed by Rg3 treatment [PMC7831931]. In spinocerebellar ataxia, ATXN8OS is involved in affecting the localization and activity of splicing factors. Mutations in ATXN8OS have also been associated with amyotrophic lateral sclerosis [PMC6456668]. The repression of ATXN8OS RNA in certain cells may be due to DNA methylation or other histone modifications such as arginine methylation and serine/threonine phosphorylation [PMC2647542]. Mutant fragments related to ATXN8OS have also been cloned for further study [PMC6625414].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUCCUUCACCUGUUGCCUGGCUAGAGUUGUCUGGCUCCACUUUGAGCUCUUGCAGAACCAGCCCUUUUUCGUGUGGUCCAGGAAAGUCCAUGCCUGGCACCACCUCCUCCUCUAGUGACUCCACGUAGAAGAGAGUCCUGGCUGGCUGCUGAGUGCCCUGCCCAGGAGCCCCUUGCUGCAGCCUCGUGGCAACUGGAAGCAGGGUGCCAUUCAGCGGAUUGAAGGAAGAGGAGGAAGAGGACGGGGAGGACGAUGAAGAGGAAGAGGAGGAAGGCUUCUUCCAGAAAGUGCUCACACCGCUUCUCUCUUGGCUUUUGAGCAGGCGACUCUGGCUGGGUCCCCAGUGCUCAAAGCUGCCACUGCCGUCCUGUUGCAGGCAGCCUCCCCCCGCCGGGCCGCCGGUGGAAGGAGACGGGUGGCUGAAGAGUUUCCAGCGGAGUCGCAGAAUGUGCUUCACAUCGAAGUCUUUUCGCCCAGAGCCUGACAUGCUUUACGCACAGAAGGCAAAAGGCUGGCAGCUCACGCAGGAUUCUGGAGGCUGGGAAGUUCAAGACCAAUGCACGAGAAUUUGGUCUAAAGAGAAUCUUCUUGCUCUGAACACACAUAGUAGAAGGCAGAAGGGCAAGAGAGAGAACAAAGUCUGUGUCUCCACAUGGCAGAAGAGCAGAGGAGACAGAACCUACUCCUCUAUGGCAACCACCCCAUCAAUGACAAAAAUCCUAGAAGGAUGUAUGUAUAGGAAGUUGAAGUGUUGAGAAGAGAAUGGCUCAGAGUCAAGCGGGAACAAGAUUCAAACUUCAGAGAGAGAGGGAAGAAAAACAUUUAAAUAUAUCUGGCAUAAUCCAAGACUAUUUACGACAAGUGUUCUGUGUUUCUAAUAAUAAAACAGACUUCACCUCGGAGUACCUGCAGAACUGGGACCCCAAUGACCAGGGAGAAUGAAGAACAACUUGUUGAAGAUUGCCUUUUCUGACUCCCAGCUUCCACGGAGAGAUUAACUCUGUUGGCUGAAGCCCUAUUCCCAAUUCCUUGGCUAGACCCUGGGUCCUUCAUGUUAGAAAACCUGGCUUUACUACUACUACUACUACUACUACUACUACUACUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCUGCAUUUUUUAAAAAUAUAUUAUCUUAUUUUACUAUUUGAUGUUAUAAUUGUUAUAUAUUUUUCCACACUUCCUCAUACUGCUUAUCUCUUACUUAAGAAUUUAUGAAUAAAGAAUUGAUUUUUCAAUACAUCCUUCCAAAAAUUAUCUGAUGUUGAGUUAGUUGCUCUCUCUUGUGCAUUCUCAGUCCUCACAAGCCUUUCUCAAACACAAUGUUUAUCAAAGAAAAUUGUAGCAACCAAUAUACUUAGUGGAAUUUCUCACAGAGUUUGAGUGUAGGAAACAGUAUUCACUGUAUAUUAGUCAUUUUGCUCCCAAUAGAAGGUGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications