v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) GAS6 antisense RNA 1 (GAS6-AS1) URS000075CA64_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

GAS6-AS1: GAS6-AS1 is a long non-coding RNA (lncRNA) that has been studied in various cancers, including acute myeloid leukemia (AML) and non-small cell lung cancer (NSCLC) [PMC8576903] [PMC4302648]. In AML patients, GAS6-AS1 was found to be significantly upregulated, and its expression was an independent predictor for overall survival [PMC8576903]. GAS6-AS1 was also found to interact with E2F1 and potentially bind to nucleotides 526-728 of GAS6-AS1 [PMC8181633]. Knockdown of GAS6-AS1 in A549 and PC9 cells resulted in increased glucose consumption, lactate and pyruvate production, and enhanced ECAR [PMC8181633]. In NSCLC, GAS6-AS1 was shown to bind with YBX1 to facilitate its interaction with MYC, leading to transactivation of MYC and upregulation of IL1R1 and other oncogenic transcripts from MYC [PMC8576903]. Additionally, GAS6-AS1 was found to bind miR-24-3p in miRNA ribonucleoprotein complexes (MiRNPs) containing Ago2 [PMC8426347]. In clear cell renal cell carcinoma (ccRCC), the expression of GAS6-AS1 was higher in tumor tissues compared to adjacent-normal tissues [PMC8371955]. It is hypothesized that GAS6-AS1 may influence the proliferation, invasiveness, and glycolysis of RCC cells by affecting the activity of AMPK [PMC8371955]. Furthermore, GAS6-AS1 was predominantly localized in the nucleus and could bind with certain RNA-binding proteins [PMC8576903]. Decreased expression of GAS6-AS1 has been associated with a poor prognosis in NSCLC patients [PMC6732993].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UCAUUUUCUCUUGCUCCUGCCGUGUAAGAAGUGCCUUUUGCCUCCCACCGUGAUUCUGAGGCCUCCCCAACCAUGUGCAAUUGCACAGGCCCAGGCUGAAGAGGAAAGACAAGAGCCGCCCUGCCCAGAAACGUCCACAUGUGGGUACUGCAUUCCUACCGGUGUGACAGAGGGAAGCGGCGGUGAGCCGGGGAGGCCUCUACGCUGUCCCGCCGUGGGAUCACACCGCGAUUGCUCAAACCACACGCAAGGUCCUGCCAUCAGAGGAGAGCUCGAAGCCGCUGUGGCAGGAACAGUGGAAGCUACCCGGCUUGUUGUGGCAGAUCUGGAGGCAGCCCCCGUUCUCCUGGCUGCAUUCGUUGACAUCUGGGAACAAGCACAGGCCUGAAGGGGAGCCCAAGGGUGCACAGCCCCUGGCUACGCACACAGGGGCUGGGGCUGGCCUUCGGAGUUACGAGGAAACGAGGACCAGGACCAGGGAUUCUGCAUCAGCACAGCCGCCAGGAGCCGGCCGGGGCCCCAUCCCUGACACUGCUGUCGCCCGGCUGUACCUGGGUGCUGUGUCCGCGGGGCGUCUGGAGACGUCGAUGUGGUCAUAGCAGGGCCUGGAACGGGGAGGUCUGGCCUGAACUAGAGAAAUGAGGGGCGUAUCCGCUUCUCCACCCUGGCCUCAGAUGAAGAGGCUCUGGGGGCAGGAGGGAGUCAGACACGUGCAGGGCAGGCGGCCUGUGCAGGGCCCAACCCUCCGGCACCAGAACCUGACCUCCUCAGAGGCCCCCACCAUGGAGGGAUGUCUGGGGGAUGCUGUGCGCUGCCGCUACGAUGUUUGGUUAGAGAUUAAAGCCAUUUCAGAAGUGGACACCUGCCCAUGUGAUGCAAAGGGCUGGGAACCCGGAAAAAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications