Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-1296 precursor URS000075CA1B_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR1296: MIR1296 is a microRNA that is involved in the serotonin-mediated signaling pathway regulating myogenic differentiation [PMC8396502]. In a study using NanoString technology, it was found that MIR1296, along with other miRNAs such as miR3185, miR28, miR182, and miR614, showed significant changes in their levels with pre-shift/post-shift or change with PoMS subscales TMD or FI [PMC9105576]. In the context of Alzheimer's disease (AD), MIR1296 was found to be downregulated in the cortex of AD patients [PMC7564652]. Additionally, MIR129-2 and MIR219A1 were also downregulated in AD patients' cortex [PMC7564652]. On the other hand, MIR199A2 and MIR92A1 were upregulated in AD patients' cortex [PMC7564652]. The dysregulation of MIR129-2, MIR219A1, and other miRNAs such as MIR29B1 and MIR199A2 has been previously reported in AD patients and was confirmed by this study [PMC7564652]. However, for some miRNAs like MIR129-2, MIR1296, and MIR99A that were found to be dysregulated in AD patients' cortex by this study as well as previous studies. The specific pathways or targets associated with these dysregulations have not been identified yet [PMC7564652].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACCUACCUAACUGGGUUAGGGCCCUGGCUCCAUCUCCUUUAGGAAAACCUUCUGUGGGGAGUGGGGCUUCGACCCUAACCCAGGUGGGCUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 18 other species

Publications