v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) SOX1 overlapping transcript (SOX1-OT) URS000075CA1A_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SOX1-OT: SOX1-OT is a long non-coding RNA (lncRNA) that has been studied in relation to its potential involvement in various biological processes. Using primer pair F4-R12, a study found that a product was amplified in D6 ReN cells, suggesting that the last exon from SOX1-OT and the AK55145 gene may be part of the same transcript [PMC5641280]. In a univariate analysis, several lncRNAs were identified to have significant associations with poor survival in uveal melanoma (UM) patients. These lncRNAs included CYTOR, LHFPL3-AS1, AP000254.1, AP003352.1, UBR5-AS1, AC021087.3, LINC01637, HRAT92, PVT1, AC104129.1, AC009902.2, AL354836.1, AC109322.1 SOX1-OT and others with positive associations [PMC9876672]. Conversely A1BG-AS1 and several other lncRNAs were found to have negative associations with poor survival in UM patients [PMC9876672]. These findings suggest that SOX1-OT and other lncRNAs may play important roles in UM progression and could potentially serve as prognostic markers for this disease [PMC9876672]. Further research is needed to fully understand the functional significance of SOX1-OT and its potential implications for UM patients [PMC5641280] [PMC9876672].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AAAUAAACCACUCCAUUGCAGAAAAGCGUGGGCAGGCAGGACUUCACUCCACUGCAGCCCCGGGAAGUCGAAAUAAACAUUGAGAUGGCUUGGCAUCUUCUUCCGAGCAAGCGCAGCUCUCAGGCCGGGCCUGAGCCUGCAGCCUGUGUGCCCUCCAUCAUCAGGGCCCCCUCUCAGGACAGGCUACACCGAGGGUGGGACGGCGGACUUCCAGGGACACUUCCAAGUCGUGCCCAUGCAGAUACCUCAGUAUACACUGCCCACAGUUAAGAAACCACGACCUGAGACAUUGUUUUGAAGAGGUGAAAAUGCCUCCACUCAAGUGGCCCAGGAGCGUGAUCCAGGAAGACGAACACACAGAACCAUCUUCUGCAUGGUUUGAAAAUUCAGUGGAAACUAGGACUCCAAGCUGCUGUCCCCUCUCUGCCGCAUCUGAGGCUGGGAAAACUUCCUAGGAGAAGGCAAGAGAAAGCCACCAGACCAGAGCCGAGGACUAAACUUUAAGGUCGAAGACGGCAGAGGGGCAGGUUCUCCCCUGCACACCCCAAGGCCUCUCCUGCACCCGCGAGGCCUUCCUUGAGCGCCCAGGCCCCCGAAAUGCCUGCCCUCCUUCUGACAAAAGGAGGGGGUAGGAUGUGAAGGGGUAGUGCAACCAACAAUGUUUUUGUAAACACAACAACAGGGAAAUACAUGGAGGAAAUCUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications