v22

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) microRNA bta-mir-15b precursor URS000075C9FE_9913

Automated summary: This pre miRNA sequence is 98 nucleotides long and is found in Bos taurus. Annotated by 4 databases (ENA, RefSeq, miRBase, Ensembl). Matches 1 Rfam family (mir-15, RF00455). Bos taurus (cattle) microRNA bta-mir-15b precursor sequence is a product of 15, ENSBTAG00000029929.2, 15b, mir-15b precursor, mir-15b precurso, MIR15B, mir-15b, bta-mir-15b precursor genes. Found in the Bos taurus reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
    		•  {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences 
    UUGAGACCUUAAAGUACUGUAGCAGCACAUCAUGGUUUACAUACUACAGUCAAGAUGCGAAUCAUUAUUUGCUGCUCUAGAAAUUUAAGGAAAUUCAU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    Publications