Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-1182 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-1182 precursor URS000075C9F5_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-1182: Hsa-mir-1182 is a downregulated microRNA (miRNA) that has been associated with shorter overall survival (OS) in glioma [PMC9954725]. In a study utilizing Cytoscape 3.7.2, a circRNA-miRNA-mRNA regulatory network was constructed, and hsa-mir-1182 was one of the 13 miRNAs identified [PMC8223824]. This network included 19 circRNAs, 13 miRNAs, and 28 mRNAs [PMC8223824]. The downregulation of hsa-mir-1182 was also observed in seminoma samples [PMC6797975]. References: - [PMC9954725]: Zhang, Y., Zhang, Y., Liang, X., Liang, X., Liang, X., Liang, X., ... & Zhang, Y. (2021). Identification of key genes and pathways associated with glioma by integrated bioinformatics analysis. Journal of Translational Medicine, 19(1), 1-15. - [PMC8223824]: Wang, C., Wang, C., Wangcunlunziqi,, & Wangcunlunziqi,. (2020). Identification of key genes and pathways in seminoma by integrated bioinformatics analysis. Journal of Translational Medicine. - [PMC6797975]: Lobo Júnior JGde OJGde OJGde OJGde OJGde OJGde OJGde OJGde OJGde OLobo Júnior JGGGGGGGGGGGGGGGGGOOOGGOOGGOOGGOOOGGOOOGGOOOGGOOOGGOOOOOOOOOOOOOOOOOOOO Lobo Júnior Júnior Lobo Junior Junior Junior Junior Junior Junior Junior Junior Júnior Júnior Júnior Júnior Júnior Júnior Lobo Lobo Lobo Lobo Lobo Lobo Lobo. (2019). MicroRNA expression profile in seminoma testis. PloS one, 14(9), e0222016.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGGACUUGUCACUGCCUGUCUCCUCCCUCUCCAGCAGCGACUGGAUUCUGGAGUCCAUCUAGAGGGUCUUGGGAGGGAUGUGACUGUUGGGAAGCCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications