Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-493 precursor URS000075C9D6_9606

  • 89 nucleotides
  • 8 databases (ENA, Ensembl, Ensembl/GENCODE, GeneCards, HGNC, MalaCards, miRBase, RefSeq)
  • Found in 16 species

Automated summary: This pre miRNA sequence is 89 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (Ensembl/GENCODE, RefSeq, Ensembl, MalaCards, ENA, GeneCards, HGNC, miRBase). Described in 36 papers. Homo sapiens (human) microRNA hsa-mir-493 precursor sequence is a product of mir-493 precurso, MIR493, mir-493 precursor, hsa-mir-493 precursor, mir-493 genes. Found in the human reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CUGGCCUCCAGGGCUUUGUACAUGGUAGGCUUUCAUUCAUUCGUUUGCACAUUCGGUGAAGGUCUACUGUGUGCCAGGCCCUGUGCCAG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 15 other species

    1. Aotus nancymaae miRNA
    2. Cercocebus atys (Sooty mangabey) miRNA
    3. Colobus angolensis palliatus microRNA 493
    4. Gorilla gorilla gorilla (Western Lowland Gorilla) microRNA 493
    5. Macaca mulatta microRNA mml-mir-493 precursor
    6. Macaca nemestrina miRNA
    7. Mandrillus leucophaeus (Drill) miRNA
    8. Nomascus leucogenys (Northern white-cheeked gibbon) miRNA
    9. Pan paniscus (bonobo) miRNA
    10. Pan troglodytes (chimpanzee) miRNA
    11. Papio anubis (Olive baboon) miRNA
    12. Piliocolobus tephrosceles (Ugandan red Colobus) microRNA 493
    13. Pongo abelii microRNA 493
    14. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-493 precursor
    15. Propithecus coquereli (Coquerel's sifaka) miRNA
    16. Rhinopithecus bieti miRNA